LXL04_001835 | RubberDandelionOmics

Gene overview

LXL04_001835

Reference: OH-1004 Chr: Chr01 Coordinates: 34774010-34776205 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · LXL04_001835|LXL04_001835|OH1004|cDNA

ATGAAGGGGCTATTCAAATCAAGGCCTCGTACCCCTGTGGAGCTCGTGTCCTACCTCCGTCACCTCCTACCTTACACCGCCCCAAATCACGTTCGTAAGAGCAAGCGCCAAGAGAAGATTTCTGAACTAAGAAAAGTCATTCATGAAATGCGGACAGTACTTTATGGAAGTGATCGATCAGAACCATTAGAAGAGCCTTGTGCAAAGCTGACACAGGAGTTCTTCAGAGGAGATACAATGCGTATGCTACTAGCATCCCT...

CDS

Download CDS FASTA

1038 bp · LXL04_001835|LXL04_001835|OH1004|CDS

ATGAAGGGGCTATTCAAATCAAGGCCTCGTACCCCTGTGGAGCTCGTGTCCTACCTCCGTCACCTCCTACCTTACACCGCCCCAAATCACGTTCGTAAGAGCAAGCGCCAAGAGAAGATTTCTGAACTAAGAAAAGTCATTCATGAAATGCGGACAGTACTTTATGGAAGTGATCGATCAGAACCATTAGAAGAGCCTTGTGCAAAGCTGACACAGGAGTTCTTCAGAGGAGATACAATGCGTATGCTACTAGCATCCCT...

Protein

Download Protein FASTA

345 aa · LXL04_001835|LXL04_001835|OH1004|PROTEIN

MKGLFKSRPRTPVELVSYLRHLLPYTAPNHVRKSKRQEKISELRKVIHEMRTVLYGSDRSEPLEEPCAKLTQEFFRGDTMRMLLASLPNLDPGTRQDITHVLANLQTQRPNGRCIASEYLESNTDLLDMLLPGTDDSELAITYGTILRDFIRHQVAARYILESDRLKRFFIYMQDPSFDIASDAAGTFKELLTRHKSTAADFLSKNYDWFFQEYNTLLKSTNYITRRNAVKLLGAMLLDRSNTPIMVRYVCSLDNMRIHM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001835`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001835

Location Chr01:34774010-34776205 (-)

Description Similar to At4g17270: Putative MO25-like protein At4g17270

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17270`	Putative MO25-like protein At4g17270.	No verified direct reference in this release
`At5g47540`	Putative MO25-like protein At5g47540.	No verified direct reference in this release
`At2g03410`	MO25-like protein At2g03410.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001835 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0043539 protein serine/threonine kinase activator activity Molecular Function

KEGG gene cross-reference

ath:AT2G03410

ath:AT4G17270

ath:AT5G47540

hsa:81617

mmu:69008

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.686

Rank 1 · LXL04_001835 · OH-1004

Nucleus0.225

Rank 2 · LXL04_001835 · OH-1004

Cell membrane0.150

Rank 3 · LXL04_001835 · OH-1004

Golgi apparatus0.098

Rank 4 · LXL04_001835 · OH-1004

Lysosome / Vacuole0.078

Rank 5 · LXL04_001835 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08569.18Mo254-333 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001835	`PF08569.18`	Mo25	4	333	3.1e-116	389.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M0M4`	Arabidopsis thaliana	Putative MO25-like protein At4g17270	58.601%	Swiss-Prot	strong database homology
`Q9FGK3`	Arabidopsis thaliana	Putative MO25-like protein At5g47540	59.064%	Swiss-Prot	strong database homology
`Q9ZQ77`	Arabidopsis thaliana	MO25-like protein At2g03410	53.529%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card