LXL04_001789 | RubberDandelionOmics

Gene overview

LXL04_001789

Reference: OH-1004 Chr: Chr01 Coordinates: 33471996-33480527 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2118 bp · LXL04_001789|LXL04_001789|OH1004|cDNA

ATGGTCATGATTATGATTGAGAAGGATGCTCTATTTCTATCTCAAAATCATTTTTTGCATAATAATTTTGTCCAATTTCAGAAAGCATCCGTGAGTGAGAGAGATGCCCAATTGCGAGCTGAAATCAAGCAACTGTTGAAGGAGACGTCCACTTTATCAGAGCCTTCAACATTTGCTCAATCTGCAAAGCTTAGAAGACTCGCAGTAGCTAAGGAGAAAGAGCTTGCAAAAAGTCAAGAGTCGGCCAGTAAGGAGATAAA...

CDS

Download CDS FASTA

2118 bp · LXL04_001789|LXL04_001789|OH1004|CDS

ATGGTCATGATTATGATTGAGAAGGATGCTCTATTTCTATCTCAAAATCATTTTTTGCATAATAATTTTGTCCAATTTCAGAAAGCATCCGTGAGTGAGAGAGATGCCCAATTGCGAGCTGAAATCAAGCAACTGTTGAAGGAGACGTCCACTTTATCAGAGCCTTCAACATTTGCTCAATCTGCAAAGCTTAGAAGACTCGCAGTAGCTAAGGAGAAAGAGCTTGCAAAAAGTCAAGAGTCGGCCAGTAAGGAGATAAA...

Protein

Download Protein FASTA

705 aa · LXL04_001789|LXL04_001789|OH1004|PROTEIN

MVMIMIEKDALFLSQNHFLHNNFVQFQKASVSERDAQLRAEIKQLLKETSTLSEPSTFAQSAKLRRLAVAKEKELAKSQESASKEIKTSFSMYEKILMISKIVIYLTMIVCFWRIHVAAISKELVQPFGNPFSFFPLLYYSIDAYHRKKIEKTMKKGSTKATKTERVVFDDEEQRRLELQREREKQKEAEVEALKRSMQSGMEQAMNSPFPVKIRYSSQTMYQYGSTTIIDYITKNPTMAKQEEVILLDFWASMYGMKVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001789`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001789

Location Chr01:33471996-33480527 (+)

Description Similar to Probable glutathione S-transferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17180`	May be involved in the conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles and have a detoxification role against certain herbicides.	No verified direct reference in this release
`At1g78380`	Catalyzes the glutathionylation of 12-oxophytodienoate (OPDA).	Probing the diversity of the Arabidopsis glutathione S-transferase gene family.2002 · DOI: 10.1023/a:1015557300450 Organ-specific expression of glutathione S-transferases and the efficacy of herbicide safeners in Arabidopsis.2006 · DOI: 10.1104/pp.105.067199 Selective binding of glutathione conjugates of fatty acid derivatives by plant glutathione transferases.2009 · DOI: 10.1074/jbc.m109.020107
`At1g17170`	May be involved in the conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles and have a detoxification role against certain herbicides.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001789 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006749 glutathione metabolic process Biological Process

GO:0009407 toxin catabolic process Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0046256 2,4,6-trinitrotoluene catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004364 glutathione transferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G17180

nta:107782951

nta:107823949

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.306

Rank 1 · LXL04_001789 · OH-1004

Mitochondrion0.211

Rank 2 · LXL04_001789 · OH-1004

Peroxisome0.186

Rank 3 · LXL04_001789 · OH-1004

Endoplasmic reticulum0.177

Rank 4 · LXL04_001789 · OH-1004

Nucleus0.131

Rank 5 · LXL04_001789 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02798.27GST_N355-427 aa

PF13417.13GST_N_3358-427 aa

PF13409.13GST_N_2364-427 aa

PF13410.12GST_C_2471-538 aa

PF13410.12GST_C_2665-704 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001789	`PF02798.27`	GST_N	355	427	1.9e-21	76.9
LXL04_001789	`PF13417.13`	GST_N_3	358	427	5.2e-20	72.3
LXL04_001789	`PF13409.13`	GST_N_2	364	427	1.4e-15	58.4
LXL04_001789	`PF13410.12`	GST_C_2	471	538	4.1e-15	56.4
LXL04_001789	`PF13410.12`	GST_C_2	665	704	4.1e-15	56.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHH7`	Arabidopsis thaliana	Glutathione S-transferase U25	61.009%	Swiss-Prot	weak database homology
`Q9ZRW8`	Arabidopsis thaliana	Glutathione S-transferase U19	59.813%	Swiss-Prot	weak database homology
`Q9SHH6`	Arabidopsis thaliana	Glutathione S-transferase U24	61.009%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card