LXL04_001751 | RubberDandelionOmics

Gene overview

LXL04_001751

Reference: OH-1004 Chr: Chr01 Coordinates: 32499207-32503374 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2454 bp · LXL04_001751|LXL04_001751|OH1004|cDNA

ATGGCGGATGATAGAGGAGGTGGGTGGTTTCCGCCGATGGATCTGTTCCGTTCAGAGCCCATGCATTTGGTACAACTCATAATTCCTATTGAGTCCGTTCACTTGACCGTCTCTTACCTCGGAGATATCGGCCTCATTCAATTCAAAGATCTAAATGCAGACAAAAGTCCTTTTCAGCGAACATATGCAATCCAGATCAAAAGATGTGGAGAAATGGCACGAAAGCTGCGGTTCTTCAAAGAACAAATGTCAAAAGCCGG...

CDS

Download CDS FASTA

2454 bp · LXL04_001751|LXL04_001751|OH1004|CDS

ATGGCGGATGATAGAGGAGGTGGGTGGTTTCCGCCGATGGATCTGTTCCGTTCAGAGCCCATGCATTTGGTACAACTCATAATTCCTATTGAGTCCGTTCACTTGACCGTCTCTTACCTCGGAGATATCGGCCTCATTCAATTCAAAGATCTAAATGCAGACAAAAGTCCTTTTCAGCGAACATATGCAATCCAGATCAAAAGATGTGGAGAAATGGCACGAAAGCTGCGGTTCTTCAAAGAACAAATGTCAAAAGCCGG...

Protein

Download Protein FASTA

817 aa · LXL04_001751|LXL04_001751|OH1004|PROTEIN

MADDRGGGWFPPMDLFRSEPMHLVQLIIPIESVHLTVSYLGDIGLIQFKDLNADKSPFQRTYAIQIKRCGEMARKLRFFKEQMSKAGITISSKPNLLVDVHLDDVEARLGELESELIEINTNNEKLQRSYNEFTEYKLVLQKAGEFFKAALSSAEVKQREYNKSPHNQPVESLSIPLLKDDELKLGFLTGLVPKEKAMAFERILFRATRGNVFLKQTPLEEPVVDPTSGQKVQKNVFAVFFSGETLKSKIVKISDAFGAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001751`
TK1151 ID	TkA01G515080
OH-1004 ID	LXL04_001751
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 59.119 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001751

Location Chr01:32499207-32503374 (-)

Description Similar to VHA-a3: V-type proton ATPase subunit a3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39080`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Arabidopsis V-ATPase activity at the tonoplast is required for efficient nutrient storage but not for sodium accumulation.2010 · DOI: 10.1073/pnas.0913035107
`At2g21410`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Arabidopsis V-ATPase activity at the tonoplast is required for efficient nutrient storage but not for sodium accumulation.2010 · DOI: 10.1073/pnas.0913035107
`At2g28520`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Reduced V-ATPase activity in the trans-Golgi network causes oxylipin-dependent hypocotyl growth Inhibition in Arabidopsis.2008 · DOI: 10.1105/tpc.108.058362

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001751 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001503 ossification Biological Process

GO:0006885 regulation of pH Biological Process

GO:0007035 vacuolar acidification Biological Process

GO:0015986 proton motive force-driven ATP synthesis Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0051452 intracellular pH reduction Biological Process

GO:0070070 proton-transporting V-type ATPase complex assembly Biological Process

GO:0097254 renal tubular secretion Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:2000012 regulation of auxin polar transport Biological Process

GO:0000220 vacuolar proton-transporting V-type ATPase, V0 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT2G21410

ath:AT2G28520

ath:AT4G39080

hsa:50617

mmu:11975

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.399

Rank 1 · LXL04_001751 · OH-1004

Golgi apparatus0.255

Rank 2 · LXL04_001751 · OH-1004

Cytoplasm0.231

Rank 3 · LXL04_001751 · OH-1004

Cell membrane0.165

Rank 4 · LXL04_001751 · OH-1004

Lysosome / Vacuole0.159

Rank 5 · LXL04_001751 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01496.25V_ATPase_I39-807 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001751	`PF01496.25`	V_ATPase_I	39	807	7.2e-297	987.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4S4`	Arabidopsis thaliana	V-type proton ATPase subunit a3	72.010%	Swiss-Prot	strong database homology
`Q9SJT7`	Arabidopsis thaliana	V-type proton ATPase subunit a2	70.988%	Swiss-Prot	strong database homology
`Q8RWZ7`	Arabidopsis thaliana	V-type proton ATPase subunit a1	60.763%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card