LXL04_001645 | RubberDandelionOmics

Gene overview

LXL04_001645

Reference: OH-1004 Chr: Chr01 Coordinates: 30743522-30745374 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

986 bp · LXL04_001645|LXL04_001645|OH1004|cDNA

AGCGCAAGAAATGGTGTGACTTGTGCAAATGCTCCATATCCAATAATCCATCCACAATCAAGAATCATGACCTTGGGCCACGTCACAAAGATAATCTTGCCAAGATGTCTAACATGAAAGAAGAGAAAGCTGCTAAAGACAAAGAAAAAAAGAAATCTGCCCGTGTTCTAACACTCACACAAATTGAAGAGAAAGCAAGTCGTAGTAATAAAAATGGCAAGACTAGAGATTCTAATGCAACTACATTAGGTGCTCAAACA...

CDS

Download CDS FASTA

966 bp · LXL04_001645|LXL04_001645|OH1004|CDS

TTGTGCAAATGCTCCATATCCAATAATCCATCCACAATCAAGAATCATGACCTTGGGCCACGTCACAAAGATAATCTTGCCAAGATGTCTAACATGAAAGAAGAGAAAGCTGCTAAAGACAAAGAAAAAAAGAAATCTGCCCGTGTTCTAACACTCACACAAATTGAAGAGAAAGCAAGTCGTAGTAATAAAAATGGCAAGACTAGAGATTCTAATGCAACTACATTAGGTGCTCAAACAAAAGAAGGGTTAGGTGATAT...

Protein

Download Protein FASTA

321 aa · LXL04_001645|LXL04_001645|OH1004|PROTEIN

MCKCSISNNPSTIKNHDLGPRHKDNLAKMSNMKEEKAAKDKEKKKSARVLTLTQIEEKASRSNKNGKTRDSNATTLGAQTKEGLGDISTMVELSGDWQRDMSLGYYYNQTNCCYYDPNSGFYYTDALGKWVTLKEVLDAIPKLSSGPTKSQTSEIGQHHKDNVTKRPSNKRVAKDKKKKKKKKAGEVEEKETHIYENDTSAFHETSLDAQTSNEGIDDSSTMFGDWEHDMLSGYYYNLNNGCFYDPNSGLFYTHHLGKWV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001645`
TK1151 ID	TkA01G520640
OH-1004 ID	LXL04_001645
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.300
Protein coverage (%)	TK1151 97.329 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001645

Location Chr01:30743522-30745374 (-)

Description Similar to ZOP1: Zinc finger protein ZOP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49590`	Nucleic acid-binding protein that promotes Pol IV-dependent small interfering RNA (siRNA) accumulation, DNA methylation and transcriptional silencing.	The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis.2013 · DOI: 10.1038/emboj.2013.49

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001645 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009845 seed germination Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0015030 Cajal body Cellular Component

GO:0071011 precatalytic spliceosome Cellular Component

GO:0003690 double-stranded DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003725 double-stranded RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G49590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.585

Rank 1 · LXL04_001645 · OH-1004

Cytoplasm0.397

Rank 2 · LXL04_001645 · OH-1004

Cell membrane0.045

Rank 3 · LXL04_001645 · OH-1004

Mitochondrion0.039

Rank 4 · LXL04_001645 · OH-1004

Endoplasmic reticulum0.030

Rank 5 · LXL04_001645 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17780.7OCRE100-133 aa

PF17780.7OCRE225-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001645	`PF17780.7`	OCRE	100	133	3.3e-20	72.5
LXL04_001645	`PF17780.7`	OCRE	225	262	3.3e-20	72.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XA66`	Arabidopsis thaliana	Zinc finger protein ZOP1	45.946%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card