LXL04_001644 | RubberDandelionOmics

Gene overview

LXL04_001644

Reference: OH-1004 Chr: Chr01 Coordinates: 30740102-30741219 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

762 bp · LXL04_001644|LXL04_001644|OH1004|cDNA

ATGGTGTTATGTACATTTGATTTAATATCACTGACATGTAATATCTTTGTATTTCAGTATTGGGTTAGTCAGGGCAAAAAATGGTGCGACTTGTGCAAAATCTTCATATCCAATAATCCTTCCAGCATCAGGAACCATGACCTTGGTCAACGTCACAAAGATAATGTCACCAAAAGGCTGTCTAACATGAGAGAAGAGAAAGTTGctaaagataaaaaaaataaagaaactGCTCGTGTTCTCACACAAATTGAAGAGAA...

CDS

Download CDS FASTA

762 bp · LXL04_001644|LXL04_001644|OH1004|CDS

ATGGTGTTATGTACATTTGATTTAATATCACTGACATGTAATATCTTTGTATTTCAGTATTGGGTTAGTCAGGGCAAAAAATGGTGCGACTTGTGCAAAATCTTCATATCCAATAATCCTTCCAGCATCAGGAACCATGACCTTGGTCAACGTCACAAAGATAATGTCACCAAAAGGCTGTCTAACATGAGAGAAGAGAAAGTTGCTAAAGATAAAAAAAATAAAGAAACTGCTCGTGTTCTCACACAAATTGAAGAGAA...

Protein

Download Protein FASTA

253 aa · LXL04_001644|LXL04_001644|OH1004|PROTEIN

MVLCTFDLISLTCNIFVFQYWVSQGKKWCDLCKIFISNNPSSIRNHDLGQRHKDNVTKRLSNMREEKVAKDKKNKETARVLTQIEEKASLSYQKDISSFQKARDSNANSQTSGEGIGDGSLMPGEWEQDTSSGYHYNKSNGCYYDPNSGFYYTDSLGKWVTLQEALAALPKLPSKPIQKKPNFATSSSSLTSKSQTPTQSANRPSSIYINKRKRPDSKPKVVSEEEAAALKAREAARKRVQEREKSSLGLYKH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001644`
TK1151 ID	TkA01G520650
OH-1004 ID	LXL04_001644
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.900
Protein coverage (%)	TK1151 99.167 / OH-1004 92.885 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001644

Location Chr01:30740102-30741219 (-)

Description Similar to ZOP1: Zinc finger protein ZOP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49590`	Nucleic acid-binding protein that promotes Pol IV-dependent small interfering RNA (siRNA) accumulation, DNA methylation and transcriptional silencing.	The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis.2013 · DOI: 10.1038/emboj.2013.49

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001644 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009845 seed germination Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0015030 Cajal body Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0071005 U2-type precatalytic spliceosome Cellular Component

GO:0071011 precatalytic spliceosome Cellular Component

KEGG gene cross-reference

ath:AT1G49590

gga:418829

hsa:11193

mmu:22380

rno:114765

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.549

Rank 1 · LXL04_001644 · OH-1004

Cytoplasm0.490

Rank 2 · LXL04_001644 · OH-1004

Mitochondrion0.051

Rank 3 · LXL04_001644 · OH-1004

Cell membrane0.037

Rank 4 · LXL04_001644 · OH-1004

Golgi apparatus0.037

Rank 5 · LXL04_001644 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06220.19zf-U126-59 aa

PF17780.7OCRE126-164 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001644	`PF06220.19`	zf-U1	26	59	2.2e-06	28.1
LXL04_001644	`PF17780.7`	OCRE	126	164	2.3e-11	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XA66`	Arabidopsis thaliana	Zinc finger protein ZOP1	48.790%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card