LXL04_001635 | RubberDandelionOmics

Gene overview

LXL04_001635

Reference: OH-1004 Chr: Chr01 Coordinates: 30637236-30642391 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3345 bp · LXL04_001635|LXL04_001635|OH1004|cDNA

aatagaaaagaAGCAATAGAAATCTTGCAACGTTTTCTCCAAGCTACCACACATATAAGCATAAGCTCCATTTTGCCCTCTGCAACCACATCACAGTTTTCAATTTCGTTACCTCCATTGATGATGGAGAGAGCTGTTCTTCTTCGCTCTATCTCCTCATGCACTTCACATGCCTGTATACGCACTTTCACTCGTTCTTCCCATCGTCTTTCCTCCAATCGCCACCGTCTTATCCCTAATATCCACCGACGTTCTCCTCC...

CDS

Download CDS FASTA

3321 bp · LXL04_001635|LXL04_001635|OH1004|CDS

TTGCAACGTTTTCTCCAAGCTACCACACATATAAGCATAAGCTCCATTTTGCCCTCTGCAACCACATCACAGTTTTCAATTTCGTTACCTCCATTGATGATGGAGAGAGCTGTTCTTCTTCGCTCTATCTCCTCATGCACTTCACATGCCTGTATACGCACTTTCACTCGTTCTTCCCATCGTCTTTCCTCCAATCGCCACCGTCTTATCCCTAATATCCACCGACGTTCTCCTCCTCGCCGCCACCTCCGCCTTATCTC...

Protein

Download Protein FASTA

1106 aa · LXL04_001635|LXL04_001635|OH1004|PROTEIN

MQRFLQATTHISISSILPSATTSQFSISLPPLMMERAVLLRSISSCTSHACIRTFTRSSHRLSSNRHRLIPNIHRRSPPRRHLRLISTALPSRLHFNTRFSPVTPKAIATSSPQFSPDAIGAHDDVAEKLGFEKVSEQFIDECKSTAVLYKHKKTGCEVMSVSNDDENKVFGVVFRTPPKDSTGIPHILEHSVLCGSRKYPLKEPFVELLKGSLHTFLNAFTYPDRTCYPVASTNTKDFYNLVDVYLDAVFFPNCVEDIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001635`
TK1151 ID	TkA01G520970
OH-1004 ID	LXL04_001635
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 99.371 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001635

Location Chr01:30637236-30642391 (-)

Description Similar to PREP2: Presequence protease 2, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49630`	ATP-independent protease that degrades both mitochondrial and chloroplastic transit peptides after their cleavage.	No verified direct reference in this release
`At3g19170`	ATP-independent protease that degrades both mitochondrial and chloroplastic transit peptides after their cleavage.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001635 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0016485 protein processing Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT1G49630

ath:AT3G19170

cpe:CPE1402

dre:406808

spo:2540111

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.822

Rank 1 · LXL04_001635 · OH-1004

Mitochondrion0.216

Rank 2 · LXL04_001635 · OH-1004

Cytoplasm0.075

Rank 3 · LXL04_001635 · OH-1004

Peroxisome0.033

Rank 4 · LXL04_001635 · OH-1004

Nucleus0.030

Rank 5 · LXL04_001635 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00675.26Peptidase_M16179-254 aa

PF05193.27Peptidase_M16_C326-512 aa

PF08367.17M16C_assoc591-840 aa

PF22516.2PreP_C913-1085 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001635	`PF00675.26`	Peptidase_M16	179	254	2.3e-06	28.3
LXL04_001635	`PF05193.27`	Peptidase_M16_C	326	512	6.6e-34	118.1
LXL04_001635	`PF08367.17`	M16C_assoc	591	840	2.5e-78	263.5
LXL04_001635	`PF22516.2`	PreP_C	913	1085	6.3e-84	280.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY06`	Arabidopsis thaliana	Presequence protease 2, chloroplastic/mitochondrial	76.105%	Swiss-Prot	strong database homology
`Q9LJL3`	Arabidopsis thaliana	Presequence protease 1, chloroplastic/mitochondrial	75.470%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card