LXL04_001532 | RubberDandelionOmics

Gene overview

LXL04_001532

Reference: OH-1004 Chr: Chr01 Coordinates: 28498052-28510102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2958 bp · LXL04_001532|LXL04_001532|OH1004|cDNA

ATGGAAGATGAAGGTGTTGAAACAGCTTTGATTGAAGACGAGAAGAAAGTGTTGAAGGTTAGATCGAAAGGGGAAGCTAGGGATTGGACGGATGCTCTTCCGATTGGAAATGGGCGTCTTGGTGGTATGATTTGGGGCGGTGTTTCCTCTGAAGTTATCAATCTTAATGAACAAAACGAACGGAATCCAGGAATATTCCGGCGAGAAAAGAAACGCGATTCCGTTTGTAGATGCGGCCGTTTGTTGCAGGTTGCTCCGGC...

CDS

Download CDS FASTA

2958 bp · LXL04_001532|LXL04_001532|OH1004|CDS

ATGGAAGATGAAGGTGTTGAAACAGCTTTGATTGAAGACGAGAAGAAAGTGTTGAAGGTTAGATCGAAAGGGGAAGCTAGGGATTGGACGGATGCTCTTCCGATTGGAAATGGGCGTCTTGGTGGTATGATTTGGGGCGGTGTTTCCTCTGAAGTTATCAATCTTAATGAACAAAACGAACGGAATCCAGGAATATTCCGGCGAGAAAAGAAACGCGATTCCGTTTGTAGATGCGGCCGTTTGTTGCAGGTTGCTCCGGC...

Protein

Download Protein FASTA

985 aa · LXL04_001532|LXL04_001532|OH1004|PROTEIN

MEDEGVETALIEDEKKVLKVRSKGEARDWTDALPIGNGRLGGMIWGGVSSEVINLNEQNERNPGIFRREKKRDSVCRCGRLLQVAPARLERKLEQDSSSGSDLCRIQKRPRLLVCLFSRIVVEREDRRRRQYGVVDNSVVISTGGCDDSWFFTFNNDGLLVCLFSRIGSERQFAPNGLEEKKLARKSFTTVGAFYYKRVWCEGEAKDWTDALPIGNRRLGGMIWGGVFSEIINLNEDTLWTGSPGNYTNPDAPKALSEVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001532`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001532

Location Chr01:28498052-28510102 (+)

Description Similar to FUC95A: Alpha-L-fucosidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34260`	Hydrolyzes alpha-1,2-linked fucose.	Identification of an Arabidopsis gene encoding a GH95 alpha1,2-fucosidase active on xyloglucan oligo- and polysaccharides.2008 · DOI: 10.1016/j.phytochem.2008.03.024 AXY8 encodes an α-fucosidase, underscoring the importance of apoplastic metabolism on the fine structure of Arabidopsis cell wall polysaccharides.2011 · DOI: 10.1105/tpc.111.089193

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001532 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0010411 xyloglucan metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004560 alpha-L-fucosidase activity Molecular Function

GO:0047513 1,2-alpha-L-fucosidase activity Molecular Function

KEGG gene cross-reference

ani:ANIA_08149

ath:AT4G34260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.505

Rank 1 · LXL04_001532 · OH-1004

Nucleus0.159

Rank 2 · LXL04_001532 · OH-1004

Extracellular0.122

Rank 3 · LXL04_001532 · OH-1004

Lysosome / Vacuole0.118

Rank 4 · LXL04_001532 · OH-1004

Endoplasmic reticulum0.106

Rank 5 · LXL04_001532 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14498.13Glyco_hyd_65N_223-58 aa

PF14498.13Glyco_hyd_65N_2200-436 aa

PF22124.3Glyco_hydro_95_cat464-877 aa

PF21307.3Glyco_hydro_95_C880-968 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001532	`PF14498.13`	Glyco_hyd_65N_2	23	58	2.8e-74	250.7
LXL04_001532	`PF14498.13`	Glyco_hyd_65N_2	200	436	2.8e-74	250.7
LXL04_001532	`PF22124.3`	Glyco_hydro_95_cat	464	877	5e-177	589.6
LXL04_001532	`PF21307.3`	Glyco_hydro_95_C	880	968	3.9e-16	60.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7W8`	Arabidopsis thaliana	Alpha-L-fucosidase 2	63.990%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card