LXL04_001465 | RubberDandelionOmics

Gene overview

LXL04_001465

Reference: OH-1004 Chr: Chr01 Coordinates: 27245499-27247055 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

963 bp · LXL04_001465|LXL04_001465|OH1004|cDNA

ATGTACAACTTGGAAAGCATAACGTACAACCACAGTCACAGCCGATTGCTAAGGATCAAGCAGGGAAGGAAAATTCACATGGATTCAAGGCTCTTGAATGATTTCCCGCAAAGCCGACTCGAAACCCTCCACCTCTGCAAAGAAGGGAGTTCCCCTTCTCCTACACCACCTACACCACAAGGCGTATCAAATTGCTTCGTTTTCAAAAGCCGACTGCAAGAGTACGCTCAAAAAGCAGGACTCACCACACCCATCTATCA...

CDS

Download CDS FASTA

963 bp · LXL04_001465|LXL04_001465|OH1004|CDS

ATGTACAACTTGGAAAGCATAACGTACAACCACAGTCACAGCCGATTGCTAAGGATCAAGCAGGGAAGGAAAATTCACATGGATTCAAGGCTCTTGAATGATTTCCCGCAAAGCCGACTCGAAACCCTCCACCTCTGCAAAGAAGGGAGTTCCCCTTCTCCTACACCACCTACACCACAAGGCGTATCAAATTGCTTCGTTTTCAAAAGCCGACTGCAAGAGTACGCTCAAAAAGCAGGACTCACCACACCCATCTATCA...

Protein

Download Protein FASTA

320 aa · LXL04_001465|LXL04_001465|OH1004|PROTEIN

MYNLESITYNHSHSRLLRIKQGRKIHMDSRLLNDFPQSRLETLHLCKEGSSPSPTPPTPQGVSNCFVFKSRLQEYAQKAGLTTPIYHTIKEGPSHQPLFRSSVVLNDETYHSLPGFLNRKAAEQSAAEIALIEIAKSGATDKSVSHPVHETGLCKNLLQEYAQKMNYAIPSYVCTKAEKKGRESPFSCTVDIGGIKYIGTSAKTKKEAELKAAKTALLAIKMSGDEYDDVVDTDTVYTVVPTKRKEPEREVIEMEGNVKM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001465`
TK1151 ID	TkA01G533540
OH-1004 ID	LXL04_001465
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001465

Location Chr01:27245499-27247055 (+)

Description Similar to DRB7: Double-stranded RNA-binding protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09700`	Double-stranded RNA-binding protein involved in RNA-mediated post-transcriptional gene silencing (PTGS).	A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin.2000 · DOI: 10.1105/tpc.12.12.2351 The Arabidopsis double-stranded RNA-binding protein HYL1 plays a role in microRNA-mediated gene regulation.2004 · DOI: 10.1073/pnas.0307969100 The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development, but not posttranscriptional transgene silencing.2004 · DOI: 10.1016/j.cub.2004.01.035 Specific interactions between Dicer-like proteins and HYL1/DRB-family dsRNA-binding proteins in Arabidopsis thaliana.2005 · DOI: 10.1007/s11103-004-6853-5 The interaction between DCL1 and HYL1 is important for efficient and precise processing of pri-miRNA in plant microRNA biogenesis.2006 · DOI: 10.1261/rna.2146906 SERRATE is a novel nuclear regulator in primary microRNA processing in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2006.02835.x The N-terminal double-stranded RNA binding domains of Arabidopsis HYPONASTIC LEAVES1 are sufficient for pre-microRNA processing.2007 · DOI: 10.1105/tpc.106.048637 The RNA-binding proteins HYL1 and SE promote accurate in vitro processing of pri-miRNA by DCL1.2008 · DOI: 10.1073/pnas.0803356105 Gene structures and processing of Arabidopsis thaliana HYL1-dependent pri-miRNAs.2009 · DOI: 10.1093/nar/gkp189 The Arabidopsis thaliana double-stranded RNA binding protein DRB1 directs guide strand selection from microRNA duplexes.2009 · DOI: 10.1261/rna.1646909 Structure of Arabidopsis HYPONASTIC LEAVES1 and its molecular implications for miRNA processing.2010 · DOI: 10.1016/j.str.2010.02.006
`At3g26932`	Binds double-stranded RNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0109900`	Binds double-stranded RNA.	No verified direct reference in this release
`Os12g0109900`	Binds double-stranded RNA.	No verified direct reference in this release
`Os05g0307400`	Binds double-stranded RNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001465 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0009733 response to auxin Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010267 ta-siRNA processing Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010589 leaf proximal/distal pattern formation Biological Process

GO:0031054 pre-miRNA processing Biological Process

GO:0035196 miRNA processing Biological Process

GO:0035279 miRNA-mediated gene silencing by mRNA destabilization Biological Process

GO:0042659 regulation of cell fate specification Biological Process

KEGG gene cross-reference

ath:AT1G09700

ath:AT3G26932

dosa:Os05g0307400

dosa:Os11g0109900

dosa:Os12g0109900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.931

Rank 1 · LXL04_001465 · OH-1004

Cytoplasm0.137

Rank 2 · LXL04_001465 · OH-1004

Cell membrane0.031

Rank 3 · LXL04_001465 · OH-1004

Endoplasmic reticulum0.020

Rank 4 · LXL04_001465 · OH-1004

Mitochondrion0.012

Rank 5 · LXL04_001465 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00035.33dsrm69-131 aa

PF00035.33dsrm155-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001465	`PF00035.33`	dsrm	69	131	2e-32	112.3
LXL04_001465	`PF00035.33`	dsrm	155	218	2e-32	112.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04492`	Arabidopsis thaliana	Double-stranded RNA-binding protein 1	62.703%	Swiss-Prot	moderate database homology
`Q9LJF5`	Arabidopsis thaliana	Double-stranded RNA-binding protein 3	34.737%	Swiss-Prot	moderate database homology
`Q0IV63`	Oryza sativa subsp. japonica	Double-stranded RNA-binding protein 7	59.908%	Swiss-Prot	moderate database homology
`Q0IQN6`	Oryza sativa subsp. japonica	Double-stranded RNA-binding protein 8	59.447%	Swiss-Prot	moderate database homology
`Q0DJA3`	Oryza sativa subsp. japonica	Double-stranded RNA-binding protein 3	59.459%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card