LXL04_001313 | RubberDandelionOmics

Gene overview

LXL04_001313

Reference: OH-1004 Chr: Chr01 Coordinates: 23911355-23915403 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2142 bp · LXL04_001313|LXL04_001313|OH1004|cDNA

ATGATTGTAAGAACGCCTCTACCTAAGAAACGAAGGTCCGATACGACCGGCAACTCGGAGAGCCCTAACTCTGATGGCCGTTTGGTGATCTTCGAGGACCTGCCGGAGCCGGAACCCTCTCACCAACATTCCGATCAGATGCTTTGCACCTACCAGTGCCGGCAACTGGTCAAGGCAGATTTCATAGATGCTTTAAGCAGTGCAGAGAAGCAATCACAAAGTTATCAATCCAAACTTGAGGCAATGAATGATGACTTCCA...

CDS

Download CDS FASTA

2142 bp · LXL04_001313|LXL04_001313|OH1004|CDS

ATGATTGTAAGAACGCCTCTACCTAAGAAACGAAGGTCCGATACGACCGGCAACTCGGAGAGCCCTAACTCTGATGGCCGTTTGGTGATCTTCGAGGACCTGCCGGAGCCGGAACCCTCTCACCAACATTCCGATCAGATGCTTTGCACCTACCAGTGCCGGCAACTGGTCAAGGCAGATTTCATAGATGCTTTAAGCAGTGCAGAGAAGCAATCACAAAGTTATCAATCCAAACTTGAGGCAATGAATGATGACTTCCA...

Protein

Download Protein FASTA

713 aa · LXL04_001313|LXL04_001313|OH1004|PROTEIN

MIVRTPLPKKRRSDTTGNSESPNSDGRLVIFEDLPEPEPSHQHSDQMLCTYQCRQLVKADFIDALSSAEKQSQSYQSKLEAMNDDFHKSETERMKFRDQLLYAEQELAAARAREESLQDQLLKEINESQERLKKQIHVHSELEIKFKKEMDLRKNAESLLSSAEEKANLLEGKLSHVSESIEREKVRLQKDLTQLKQESKLSISRISADLEKMECKANNSEKEATMLKEQLENLQNQLNECLHEKNEVEKKLSTLTYQET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001313`
TK1151 ID	TkA01G547980
OH-1004 ID	LXL04_001313
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.700
Protein coverage (%)	TK1151 97.232 / OH-1004 73.773 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001313

Location Chr01:23911355-23915403 (-)

Description Similar to MAD1: Mitotic spindle checkpoint protein MAD1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49880`	Required for the execution of the mitotic checkpoint which monitors the process of kinetochore-spindle attachment and delays the onset of anaphase when this process is not complete.	Functional interaction between the Arabidopsis orthologs of spindle assembly checkpoint proteins MAD1 and MAD2 and the nucleoporin NUA.2012 · DOI: 10.1007/s11103-012-9903-4

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001313 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process

GO:0051301 cell division Biological Process

GO:0051315 attachment of mitotic spindle microtubules to kinetochore Biological Process

GO:0090235 regulation of metaphase plate congression Biological Process

GO:0090267 positive regulation of mitotic cell cycle spindle assembly checkpoint Biological Process

GO:0099606 microtubule plus-end directed mitotic chromosome migration Biological Process

GO:1901990 regulation of mitotic cell cycle phase transition Biological Process

GO:1902426 deactivation of mitotic spindle assembly checkpoint Biological Process

GO:0000776 kinetochore Cellular Component

GO:0000922 spindle pole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

KEGG gene cross-reference

ath:AT5G49880

cge:100689352

hsa:8379

mmu:17120

spo:2540320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.607

Rank 1 · LXL04_001313 · OH-1004

Cytoplasm0.363

Rank 2 · LXL04_001313 · OH-1004

Golgi apparatus0.042

Rank 3 · LXL04_001313 · OH-1004

Mitochondrion0.040

Rank 4 · LXL04_001313 · OH-1004

Cell membrane0.031

Rank 5 · LXL04_001313 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05557.19MAD72-711 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001313	`PF05557.19`	MAD	72	711	4.8e-28	98.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTY1`	Arabidopsis thaliana	Mitotic spindle checkpoint protein MAD1	61.761%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card