LXL04_001279 | RubberDandelionOmics

Gene overview

LXL04_001279

Reference: OH-1004 Chr: Chr01 Coordinates: 23396295-23397634 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

843 bp · LXL04_001279|LXL04_001279|OH1004|cDNA

ATGGTTGCTGCCGACTTTGTCGTCGGGATCTTAGGAAACATCGTCTCTATACTCAGTTTCACTTCTCCCATATCACAATTTCGGGAGATTGTGAAGGGAAAAAATGCTGATAACTACAACGGAACACCATATATTGCAACGTTTTTGAGTTGTTCTTTGTGGATTTTGTACGGAGTACTTGACCCAGATGATGGTCTCCTCATTGTGACTGTCAACTCAGCTGGTGTGGGCATGCAAACCCTCTACCTTGCTCTACTTTT...

CDS

Download CDS FASTA

843 bp · LXL04_001279|LXL04_001279|OH1004|CDS

ATGGTTGCTGCCGACTTTGTCGTCGGGATCTTAGGAAACATCGTCTCTATACTCAGTTTCACTTCTCCCATATCACAATTTCGGGAGATTGTGAAGGGAAAAAATGCTGATAACTACAACGGAACACCATATATTGCAACGTTTTTGAGTTGTTCTTTGTGGATTTTGTACGGAGTACTTGACCCAGATGATGGTCTCCTCATTGTGACTGTCAACTCAGCTGGTGTGGGCATGCAAACCCTCTACCTTGCTCTACTTTT...

Protein

Download Protein FASTA

280 aa · LXL04_001279|LXL04_001279|OH1004|PROTEIN

MVAADFVVGILGNIVSILSFTSPISQFREIVKGKNADNYNGTPYIATFLSCSLWILYGVLDPDDGLLIVTVNSAGVGMQTLYLALLFIYSSPEKRVKYFGFVVLDVVCFGLVVAFTLVAFHGESRRTFTGVICATFTTMMYAAPLAALRTTIKTKSVEYMPILLVFSLFVNGCVWLTFALLVTDVFVLVPNAIGILLGAIQFCVYLMFRNSRPIVNEKQTEIQEFGTEDIDVKSNNMITQKRSLSRLDAFPVIRSPSLLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001279`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001279

Location Chr01:23396295-23397634 (+)

Description Similar to SWEET16: Bidirectional sugar transporter SWEET16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16690`	Mediates both low-affinity uptake and efflux of sugar across the vacuolar membrane.	Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis.2013 · DOI: 10.1104/pp.113.224972 SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves.2014 · DOI: 10.1104/pp.113.232751
`At4g15920`	Acts as a vacuolar hexose transporter.	Leaf fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis.2013 · DOI: 10.1016/j.cub.2013.03.021 SWEET17, a facilitative transporter, mediates fructose transport across the tonoplast of Arabidopsis roots and leaves.2014 · DOI: 10.1104/pp.113.232751

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0341300`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane.	No verified direct reference in this release
`UniProt: A2YZ24`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane.	No verified direct reference in this release
`Os05g0588500`	Mediates both low-affinity uptake and efflux of sugar across the plasma membrane (By similarity).	Overexpression of OsSWEET5 in rice causes growth retardation and precocious senescence.2014 · DOI: 10.1371/journal.pone.0094210

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001279 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0008643 carbohydrate transport Biological Process

GO:0009409 response to cold Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0009750 response to fructose Biological Process

GO:0010930 negative regulation of auxin mediated signaling pathway Biological Process

GO:0015755 fructose transmembrane transport Biological Process

KEGG gene cross-reference

ath:AT3G16690

ath:AT4G15920

dosa:Os03g0341300

dosa:Os05g0588500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.618

Rank 1 · LXL04_001279 · OH-1004

Endoplasmic reticulum0.150

Rank 2 · LXL04_001279 · OH-1004

Lysosome / Vacuole0.134

Rank 3 · LXL04_001279 · OH-1004

Cytoplasm0.101

Rank 4 · LXL04_001279 · OH-1004

Golgi apparatus0.070

Rank 5 · LXL04_001279 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03083.22MtN3_slv7-93 aa

PF03083.22MtN3_slv129-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001279	`PF03083.22`	MtN3_slv	7	93	5.6e-44	148.8
LXL04_001279	`PF03083.22`	MtN3_slv	129	211	5.6e-44	148.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUR4`	Arabidopsis thaliana	Bidirectional sugar transporter SWEET16	38.767%	Swiss-Prot	moderate database homology
`Q84WN3`	Arabidopsis thaliana	Bidirectional sugar transporter SWEET17	35.950%	Swiss-Prot	moderate database homology
`Q10LN5`	Oryza sativa subsp. japonica	Bidirectional sugar transporter SWEET16	44.601%	Swiss-Prot	moderate database homology
`A2YZ24`	Oryza sativa subsp. indica	Bidirectional sugar transporter SWEET7b	35.526%	Swiss-Prot	moderate database homology
`Q6L568`	Oryza sativa subsp. japonica	Bidirectional sugar transporter SWEET5	37.668%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card