LXL04_001219 | RubberDandelionOmics

Gene overview

LXL04_001219

Reference: OH-1004 Chr: Chr01 Coordinates: 22172059-22174166 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1554 bp · LXL04_001219|LXL04_001219|OH1004|cDNA

ATGAAGGCGGACACGTCTGCATGGCGAACAGATGAAGAATTTGGAAGAGAAATGCTCGCCGGTGTAAACCCAGTGGTTATCCGTCGACTTCAAGTAACTTCAGAGTTCCCACCTGCTAGCAAGCTCGATCTTGAGGAATATGGCGACCAAACAAGCTCCATGAGAAAGGACGATCTCGAACCAAATATGAACGGATTGACAGTACAAAAAGCTTTGGAAGAAAATAAGCTGTTCATATTGGATCATCATGATGCATTGAT...

CDS

Download CDS FASTA

1554 bp · LXL04_001219|LXL04_001219|OH1004|CDS

ATGAAGGCGGACACGTCTGCATGGCGAACAGATGAAGAATTTGGAAGAGAAATGCTCGCCGGTGTAAACCCAGTGGTTATCCGTCGACTTCAAGTAACTTCAGAGTTCCCACCTGCTAGCAAGCTCGATCTTGAGGAATATGGCGACCAAACAAGCTCCATGAGAAAGGACGATCTCGAACCAAATATGAACGGATTGACAGTACAAAAAGCTTTGGAAGAAAATAAGCTGTTCATATTGGATCATCATGATGCATTGAT...

Protein

Download Protein FASTA

517 aa · LXL04_001219|LXL04_001219|OH1004|PROTEIN

MKADTSAWRTDEEFGREMLAGVNPVVIRRLQVTSEFPPASKLDLEEYGDQTSSMRKDDLEPNMNGLTVQKALEENKLFILDHHDALMPYLTRINSTASKIYATRTVLLLQNDGTLKPLAIELSLPNKPESENYPGCTSDVYTPCSDGVDATIWQLAKAYAAVNDSGYHQLISHWLNTHAVIEPFIIATNRQLSVLHPIYKLLKPHFRDTMNINALARQILINAGGVLEMTVFPEKYAMEMSAVLYKNWVFTEQALPVDLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001219`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001219

Location Chr01:22172059-22174166 (-)

Description Similar to LOX5: Linoleate 9S-lipoxygenase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22400`	9S-lipoxygenase that can use linoleic acid or linolenic acid as substrates.	Facilitation of Fusarium graminearum Infection by 9-Lipoxygenases in Arabidopsis and Wheat.2015 · DOI: 10.1094/mpmi-04-15-0096-r Enzymatic and Non-Enzymatic Mechanisms Contribute to Lipid Oxidation During Seed Aging.2017 · DOI: 10.1093/pcp/pcx036

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001219 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0006952 defense response Biological Process

GO:0010311 lateral root formation Biological Process

GO:0031408 oxylipin biosynthetic process Biological Process

GO:0034440 lipid oxidation Biological Process

GO:0048364 root development Biological Process

GO:1900366 negative regulation of defense response to insect Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0016165 linoleate 13S-lipoxygenase activity Molecular Function

GO:0016702 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:1990136 linoleate 9S-lipoxygenase activity Molecular Function

KEGG gene cross-reference

ag:AAB31252

ath:AT3G22400

sot:102577714

sot:102602192

sot:102602528

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.709

Rank 1 · LXL04_001219 · OH-1004

Nucleus0.198

Rank 2 · LXL04_001219 · OH-1004

Cell membrane0.104

Rank 3 · LXL04_001219 · OH-1004

Lysosome / Vacuole0.075

Rank 4 · LXL04_001219 · OH-1004

Endoplasmic reticulum0.067

Rank 5 · LXL04_001219 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00305.25Lipoxygenase1-495 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001219	`PF00305.25`	Lipoxygenase	1	495	5.2e-243	809.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUW0`	Arabidopsis thaliana	Linoleate 9S-lipoxygenase 5	72.727%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card