LXL04_001169 | RubberDandelionOmics

Gene overview

LXL04_001169

Reference: OH-1004 Chr: Chr01 Coordinates: 21408001-21410134 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1047 bp · LXL04_001169|LXL04_001169|OH1004|cDNA

ATGGCGCATTGCAGATCcaaattgtttttcttaatctgtTTGTCAATCCTACTGATTGCTAGTGCCGCAAAAAGTTATTATGATATACTTCAAGTTCCCAAGGGCGCATCCGACGATCAAATCAAGCGGTCCTATAGAAAGCTGGCCTTAAAATATCACCCCGACAAGAATCAAGGAAATGAAGACGCTAACAAAAAATTTGCTGAGATTAACAATGCTTATGAGGTGTTATCAAACAGTGAGAAGAGGAGTATCTACGA...

CDS

Download CDS FASTA

1047 bp · LXL04_001169|LXL04_001169|OH1004|CDS

ATGGCGCATTGCAGATCCAAATTGTTTTTCTTAATCTGTTTGTCAATCCTACTGATTGCTAGTGCCGCAAAAAGTTATTATGATATACTTCAAGTTCCCAAGGGCGCATCCGACGATCAAATCAAGCGGTCCTATAGAAAGCTGGCCTTAAAATATCACCCCGACAAGAATCAAGGAAATGAAGACGCTAACAAAAAATTTGCTGAGATTAACAATGCTTATGAGGTGTTATCAAACAGTGAGAAGAGGAGTATCTACGA...

Protein

Download Protein FASTA

348 aa · LXL04_001169|LXL04_001169|OH1004|PROTEIN

MAHCRSKLFFLICLSILLIASAAKSYYDILQVPKGASDDQIKRSYRKLALKYHPDKNQGNEDANKKFAEINNAYEVLSNSEKRSIYDRYGEEGLKQHAAGGGGGGGMDIQDIFKSFFGGGGEQEEEERVAKGDDVVIDLDATLEDLYMGGSLKVWREKNILKPAPGKRQCNCRNQVYHRQIGPGMFQQMTEQARAIPVCEQCPNVKYEREGNFITVDIEKGMQDGQEVVFYEEGEPIIDGEAGDLRFRIRTATHERFRRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001169`
TK1151 ID	TkA01G556810
OH-1004 ID	LXL04_001169
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001169

Location Chr01:21408001-21410134 (+)

Description Similar to ERDJ3B: DnaJ protein ERDJ3B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62600`	Regulates protein folding in the endoplasmic reticulum (ER) lumen.	Control of the pattern-recognition receptor EFR by an ER protein complex in plant immunity.2009 · DOI: 10.1038/emboj.2009.262

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0156500`	May play a role in protein folding in the endoplasmic reticulum.	Analysis of rice ER-resident J-proteins reveals diversity and functional differentiation of the ER-resident Hsp70 system in plants.2013 · DOI: 10.1093/jxb/ert312

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001169 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002221 pattern recognition receptor signaling pathway Biological Process

GO:0006457 protein folding Biological Process

GO:0016556 mRNA modification Biological Process

GO:0032781 positive regulation of ATP-dependent activity Biological Process

GO:0034975 protein folding in endoplasmic reticulum Biological Process

GO:0051604 protein maturation Biological Process

GO:0005615 extracellular space Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT3G62600

dosa:Os05g0156500

mmu:67838

pon:100462077

rno:360734

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.719

Rank 1 · LXL04_001169 · OH-1004

Cytoplasm0.201

Rank 2 · LXL04_001169 · OH-1004

Nucleus0.129

Rank 3 · LXL04_001169 · OH-1004

Golgi apparatus0.114

Rank 4 · LXL04_001169 · OH-1004

Extracellular0.106

Rank 5 · LXL04_001169 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ25-87 aa

PF01556.24DnaJ_C136-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001169	`PF00226.37`	DnaJ	25	87	2.3e-28	98.8
LXL04_001169	`PF01556.24`	DnaJ_C	136	332	8e-35	120.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZK5`	Arabidopsis thaliana	DnaJ protein ERDJ3B	73.607%	Swiss-Prot	strong database homology
`B9FHF3`	Oryza sativa subsp. japonica	DnaJ protein ERDJ3B	78.507%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card