LXL04_001165 | RubberDandelionOmics

Gene overview

LXL04_001165

Reference: OH-1004 Chr: Chr01 Coordinates: 21356002-21359726 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2532 bp · LXL04_001165|LXL04_001165|OH1004|cDNA

ATGTCAATCAATACGCCACGACAGAATGGCTGGCGGTTTGATATTTTACACAGCCTAGAAACATCCATATTCTTCGTCAACTTACTGAAATTTGGATCCATGGTGACACCTAAGTTTACAAGAGTCCCAAGTATGCGAGAGCGGGTTCAAGAAACTCTCTCCGCTCACCGCAACGAGATCGTCTCTCTTCTTTCCAGGTATGTAGATCAGGGGAAGGGCATTTTGCAGCCACACCACCTTCTCGACGAGATTGAGAATAC...

CDS

Download CDS FASTA

2532 bp · LXL04_001165|LXL04_001165|OH1004|CDS

ATGTCAATCAATACGCCACGACAGAATGGCTGGCGGTTTGATATTTTACACAGCCTAGAAACATCCATATTCTTCGTCAACTTACTGAAATTTGGATCCATGGTGACACCTAAGTTTACAAGAGTCCCAAGTATGCGAGAGCGGGTTCAAGAAACTCTCTCCGCTCACCGCAACGAGATCGTCTCTCTTCTTTCCAGGTATGTAGATCAGGGGAAGGGCATTTTGCAGCCACACCACCTTCTCGACGAGATTGAGAATAC...

Protein

Download Protein FASTA

843 aa · LXL04_001165|LXL04_001165|OH1004|PROTEIN

MSINTPRQNGWRFDILHSLETSIFFVNLLKFGSMVTPKFTRVPSMRERVQETLSAHRNEIVSLLSRYVDQGKGILQPHHLLDEIENTIGDHASRQKLTDSPFGEILKSAQEGIILPPYVALAVRPRPGVWEFLRVNVNELSIEQLSVSEYLVFKEELVDGQSKSPFVLELDLEPFNATFPRMSRSSSIGNGVLFLNRHLSSLMFRDKDCMEPLLDFLRAHKHKGYGMMLNDRIQNISRLESCLAKAEDYLSKQPPDTAYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001165`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001165

Location Chr01:21356002-21359726 (-)

Description Similar to SUS2: Sucrose synthase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02280`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds.2010 · DOI: 10.1007/s00425-010-1207-9
`At5g49190`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds.2010 · DOI: 10.1007/s00425-010-1207-9 Regulation of AtSUS2 and AtSUS3 by glucose and the transcription factor LEC2 in different tissues and at different stages of Arabidopsis seed development.2012 · DOI: 10.1007/s11103-011-9871-0

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0340500`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001165 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0005982 starch metabolic process Biological Process

GO:0005985 sucrose metabolic process Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0010431 seed maturation Biological Process

GO:0010555 response to mannitol Biological Process

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042170 plastid membrane Cellular Component

GO:0016157 sucrose synthase activity Molecular Function

KEGG gene cross-reference

ath:AT4G02280

ath:AT5G49190

dosa:Os03g0340500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.504

Rank 1 · LXL04_001165 · OH-1004

Nucleus0.257

Rank 2 · LXL04_001165 · OH-1004

Mitochondrion0.130

Rank 3 · LXL04_001165 · OH-1004

Peroxisome0.102

Rank 4 · LXL04_001165 · OH-1004

Plastid0.072

Rank 5 · LXL04_001165 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24861.3SUS_N42-155 aa

PF24862.2SUS_EPBD190-277 aa

PF00862.27GT-B_Sucrose_synth300-588 aa

PF00534.27Glycos_transf_1602-764 aa

PF13692.13Glyco_trans_1_4606-760 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001165	`PF24861.3`	SUS_N	42	155	1.7e-48	164.3
LXL04_001165	`PF24862.2`	SUS_EPBD	190	277	4e-32	111.2
LXL04_001165	`PF00862.27`	GT-B_Sucrose_synth	300	588	2.2e-167	555.9
LXL04_001165	`PF00534.27`	Glycos_transf_1	602	764	7.8e-27	94.6
LXL04_001165	`PF13692.13`	Glyco_trans_1_4	606	760	2.7e-13	51.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M111`	Arabidopsis thaliana	Sucrose synthase 3	78.368%	Swiss-Prot	strong database homology
`Q00917`	Arabidopsis thaliana	Sucrose synthase 2	73.724%	Swiss-Prot	strong database homology
`Q10LP5`	Oryza sativa subsp. japonica	Sucrose synthase 4	75.402%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card