LXL04_001110 | RubberDandelionOmics

Gene overview

LXL04_001110

Reference: OH-1004 Chr: Chr01 Coordinates: 20521839-20525987 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1947 bp · LXL04_001110|LXL04_001110|OH1004|cDNA

ATGGCGATCACTGTTGCGTCTTGCTGGTTTAATGCGTTAGCCTCCACAAACACTTCTCGATGCACAGTCTCCTCCCAACGGTTGTTCTCCTCGTCGCAATTATCGGCTACTCGTTTAGTCATTCCGAAAGCTGCTAGTCAGAGTCAAAATCCGAGGAAGAGAACTCCCAAGGAACATACTCACAAGTCGTCACCTGAGAAAGAAGGTAATTCTCAAAAAAATTCAAGGTCAAGAGATGAAAGAAAATATCTAGATGCTGA...

CDS

Download CDS FASTA

1947 bp · LXL04_001110|LXL04_001110|OH1004|CDS

ATGGCGATCACTGTTGCGTCTTGCTGGTTTAATGCGTTAGCCTCCACAAACACTTCTCGATGCACAGTCTCCTCCCAACGGTTGTTCTCCTCGTCGCAATTATCGGCTACTCGTTTAGTCATTCCGAAAGCTGCTAGTCAGAGTCAAAATCCGAGGAAGAGAACTCCCAAGGAACATACTCACAAGTCGTCACCTGAGAAAGAAGGTAATTCTCAAAAAAATTCAAGGTCAAGAGATGAAAGAAAATATCTAGATGCTGA...

Protein

Download Protein FASTA

648 aa · LXL04_001110|LXL04_001110|OH1004|PROTEIN

MAITVASCWFNALASTNTSRCTVSSQRLFSSSQLSATRLVIPKAASQSQNPRKRTPKEHTHKSSPEKEGNSQKNSRSRDERKYLDADDRSGIKRTEQPQSTAFKSFGTQRKSAKGFMGNLTEQQLETAKIQDASFLNAVVKVYCTHTAPDYSLPWQKQRQFTSTGRHSKFTVNAFMIGDGKLLTNAHCVEHNTQVKVKRRGDDTKYVAKVLAKGMECDIALLSVENEKFWKGAEPLQFGHLPRLQDSVTVVGYPLGGDTI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001110`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001110

Location Chr01:20521839-20525987 (+)

Description Similar to DEGP2: Protease Do-like 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47940`	Serine protease that performs the primary cleavage of the photodamaged D1 protein in plant photosystem II.	A chloroplast DegP2 protease performs the primary cleavage of the photodamaged D1 protein in plant photosystem II.2001 · DOI: 10.1093/emboj/20.4.713
`At5g40200`	Serine protease that degrades the two-component response regulator ARR4.	No verified direct reference in this release
`At5g36950`	Probable serine protease.	No verified direct reference in this release
`At1g65630`	Putative serine protease.	No verified direct reference in this release
`At1g65640`	Putative serine protease.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001110 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010206 photosystem II repair Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009533 chloroplast stromal thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT1G65630

ath:AT1G65640

ath:AT2G47940

ath:AT5G36950

ath:AT5G40200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.765

Rank 1 · LXL04_001110 · OH-1004

Mitochondrion0.115

Rank 2 · LXL04_001110 · OH-1004

Cytoplasm0.102

Rank 3 · LXL04_001110 · OH-1004

Nucleus0.054

Rank 4 · LXL04_001110 · OH-1004

Peroxisome0.051

Rank 5 · LXL04_001110 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00089.33Trypsin144-333 aa

PF13365.13Trypsin_2174-310 aa

PF13180.13PDZ_2349-448 aa

PF17815.8PDZ_3457-609 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001110	`PF00089.33`	Trypsin	144	333	4.2e-23	83.0
LXL04_001110	`PF13365.13`	Trypsin_2	174	310	4.2e-25	89.9
LXL04_001110	`PF13180.13`	PDZ_2	349	448	5.9e-06	27.2
LXL04_001110	`PF17815.8`	PDZ_3	457	609	1.5e-44	151.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82261`	Arabidopsis thaliana	Protease Do-like 2, chloroplastic	71.933%	Swiss-Prot	strong database homology
`Q9FL12`	Arabidopsis thaliana	Protease Do-like 9	48.321%	Swiss-Prot	moderate database homology
`Q9FIV6`	Arabidopsis thaliana	Protease Do-like 10, mitochondrial	43.096%	Swiss-Prot	moderate database homology
`Q9SHZ1`	Arabidopsis thaliana	Putative protease Do-like 3, mitochondrial	40.408%	Swiss-Prot	moderate database homology
`Q9SHZ0`	Arabidopsis thaliana	Protease Do-like 4, mitochondrial	40.252%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card