LXL04_001019 | RubberDandelionOmics

Gene overview

LXL04_001019

Reference: OH-1004 Chr: Chr01 Coordinates: 18615949-18618722 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

888 bp · LXL04_001019|LXL04_001019|OH1004|cDNA

ATGTCAACGGAGGAGCCACCCTTCTCTACCTCCGCCTTGTCAGCGCTTGATAAACCAGTTCAGCAGCTTACTGAAGACGACATTTCTCAGCTCACTCGCGAAGACTGTCGCCGGTATCTCAAGCAAAAAGGGATGAGACGGCCGTCTTGGAACAAATCGCAGGCGATCCAGCAAGTAATAATGCTAAAAAAGTTGCTTGAACCGGCGCCGGATTCCGAAGACGGTAGCCGGAAGCTCTGCATTACTTCACGGCAACAACA...

CDS

Download CDS FASTA

888 bp · LXL04_001019|LXL04_001019|OH1004|CDS

ATGTCAACGGAGGAGCCACCCTTCTCTACCTCCGCCTTGTCAGCGCTTGATAAACCAGTTCAGCAGCTTACTGAAGACGACATTTCTCAGCTCACTCGCGAAGACTGTCGCCGGTATCTCAAGCAAAAAGGGATGAGACGGCCGTCTTGGAACAAATCGCAGGCGATCCAGCAAGTAATAATGCTAAAAAAGTTGCTTGAACCGGCGCCGGATTCCGAAGACGGTAGCCGGAAGCTCTGCATTACTTCACGGCAACAACA...

Protein

Download Protein FASTA

295 aa · LXL04_001019|LXL04_001019|OH1004|PROTEIN

MSTEEPPFSTSALSALDKPVQQLTEDDISQLTREDCRRYLKQKGMRRPSWNKSQAIQQVIMLKKLLEPAPDSEDGSRKLCITSRQQQTPTTRVQKGTSADTEISLSAEESVPGYRNDTEKSDFLADNDSAPPGIGGLIEEAKGQMTIFYSGKVNVYDDIPADKARALLQLAASPLQFPQEDPVDGNMLQPPHINLPILQTAVRMTDSHRLHKEESNTSRDEISAEGSANRKASVQRYLEKRKDRYVLVERFKSKRKGGGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001019`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001019

Location Chr01:18615949-18618722 (-)

Description Similar to TIFY4B: Protein TIFY 4B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14720`	Regulates the arrest of dispersed meristematic cells during lamina development.	No verified direct reference in this release
`At4g14713`	Regulates the arrest of dispersed meristematic cells during lamina development.	No verified direct reference in this release
`At1g17380`	Repressor of jasmonate responses.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0615200`	Repressor of jasmonate responses.	No verified direct reference in this release
`UniProt: A2YNP2`	Repressor of jasmonate responses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001019 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0048366 leaf development Biological Process

GO:1901371 regulation of leaf morphogenesis Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G17380

ath:AT4G14713

ath:AT4G14720

dosa:Os07g0615200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.816

Rank 1 · LXL04_001019 · OH-1004

Cytoplasm0.194

Rank 2 · LXL04_001019 · OH-1004

Cell membrane0.109

Rank 3 · LXL04_001019 · OH-1004

Endoplasmic reticulum0.063

Rank 4 · LXL04_001019 · OH-1004

Plastid0.021

Rank 5 · LXL04_001019 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06200.20tify140-172 aa

PF09425.16Jas_motif228-245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001019	`PF06200.20`	tify	140	172	8e-16	57.8
LXL04_001019	`PF09425.16`	Jas_motif	228	245	2e-06	28.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY55`	Arabidopsis thaliana	Protein TIFY 4B	41.993%	Swiss-Prot	moderate database homology
`Q7XA73`	Arabidopsis thaliana	Protein TIFY 4A	38.514%	Swiss-Prot	moderate database homology
`Q9LDU5`	Arabidopsis thaliana	Protein TIFY 11A	28.095%	Swiss-Prot	weak database homology
`Q8H395`	Oryza sativa subsp. japonica	Protein TIFY 10b	37.168%	Swiss-Prot	weak database homology
`A2YNP2`	Oryza sativa subsp. indica	Protein TIFY 10b	37.168%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card