RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_000811
Reference: OH-1004 Chr: Chr01 Coordinates: 15048841-15050681 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

756 bp · LXL04_000811|LXL04_000811|OH1004|cDNA

ATGGCGACTAATTTCTGGGCATCCACGCACTACAAGATACTATTGGATCAAGAGGAAGTGGATGTGGTACCTAACCTCGATAGGGAGAGGGGAATTACCCTCGATGATTTCAAGCTCATTAAGTTGCATATGACCAATTACATTGCAAAATTGGCTCAAAATGTGAAAGTGAGGCAAAGGGTTGTAGCAACTGCTGTAACATATATGAGACGTGTTTATACAAGGAAAAGTATGACCGAATATGACCCACGGTTACTTGC...

CDS

Download CDS FASTA

756 bp · LXL04_000811|LXL04_000811|OH1004|CDS

ATGGCGACTAATTTCTGGGCATCCACGCACTACAAGATACTATTGGATCAAGAGGAAGTGGATGTGGTACCTAACCTCGATAGGGAGAGGGGAATTACCCTCGATGATTTCAAGCTCATTAAGTTGCATATGACCAATTACATTGCAAAATTGGCTCAAAATGTGAAAGTGAGGCAAAGGGTTGTAGCAACTGCTGTAACATATATGAGACGTGTTTATACAAGGAAAAGTATGACCGAATATGACCCACGGTTACTTGC...

Protein

Download Protein FASTA

251 aa · LXL04_000811|LXL04_000811|OH1004|PROTEIN

MATNFWASTHYKILLDQEEVDVVPNLDRERGITLDDFKLIKLHMTNYIAKLAQNVKVRQRVVATAVTYMRRVYTRKSMTEYDPRLLAPSCLYLAAKSEESTVQARLLVFYIKKFYADEKYRCEIKEILEMEMKILEALNYYLVVFHPYRALSQLVQDAGMSDATQLTWGLVNDTYKTDLILVHPPHLIGLACVYVASVLKEKDNTAWFEDLRVDMNVVKNIAMEILDFYDAHKMITEDRVNAAMHKLTMRT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_000811
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_000811
LocationChr01:15048841-15050681 (-)
DescriptionSimilar to CYCC1-2: Cyclin-C1-2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g48630 Cyclin-C1-2. No verified direct reference in this release
At5g48640 Cyclin-C1-1. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os09g0504400 Cyclin-C1-1. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000811 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0045023 G0 to G1 transition Biological Process
GO:0045746 negative regulation of Notch signaling pathway Biological Process
GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process
GO:0051301 cell division Biological Process
GO:0090209 negative regulation of triglyceride metabolic process Biological Process
GO:0000151 ubiquitin ligase complex Cellular Component
GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component
GO:0005634 nucleus Cellular Component
GO:0016592 mediator complex Cellular Component
GO:1990508 CKM complex Cellular Component
KEGG gene cross-reference
ath:AT5G48630
ath:AT5G48640
dosa:Os09g0504400
xla:734677
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.834
Rank 1 · LXL04_000811 · OH-1004
Cytoplasm0.258
Rank 2 · LXL04_000811 · OH-1004
Cell membrane0.027
Rank 3 · LXL04_000811 · OH-1004
Mitochondrion0.023
Rank 4 · LXL04_000811 · OH-1004
Endoplasmic reticulum0.015
Rank 5 · LXL04_000811 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00134.29Cyclin_N44-142 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_000811PF00134.29Cyclin_N441421.1e-2074.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FJK7Arabidopsis thalianaCyclin-C1-271.888%Swiss-Protstrong database homology
Q9FJK6Arabidopsis thalianaCyclin-C1-169.048%Swiss-Protstrong database homology
P93411Oryza sativa subsp. japonicaCyclin-C1-169.922%Swiss-Protstrong database homology

JBrowse

View in Genome Browser