LXL04_000785 | RubberDandelionOmics

Gene overview

LXL04_000785

Reference: OH-1004 Chr: Chr01 Coordinates: 14373316-14376081 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1437 bp · LXL04_000785|LXL04_000785|OH1004|cDNA

ATGGCGTTTCTCAACCGAAATCCTTCGCTCTGTGTTCTCGTGCTAATCTTCGCATCTCTGGTGTTTCTAACCTCGCCGGTGCATTCTCTCAACTGCTCATCGCAGAAGTTCACCAACAGCAAGCTATACAGCAAGTGCATCGATCTACCAACACTCGGCGCATCGCTCCACTGGACTCACATCGCCGAAAACTCCTCCCTCTCAATCGCATTCATCGCGCCTCCCGCTAAGCCGGACGGATGGATCGCGTGGGCTATTAA...

CDS

Download CDS FASTA

1437 bp · LXL04_000785|LXL04_000785|OH1004|CDS

ATGGCGTTTCTCAACCGAAATCCTTCGCTCTGTGTTCTCGTGCTAATCTTCGCATCTCTGGTGTTTCTAACCTCGCCGGTGCATTCTCTCAACTGCTCATCGCAGAAGTTCACCAACAGCAAGCTATACAGCAAGTGCATCGATCTACCAACACTCGGCGCATCGCTCCACTGGACTCACATCGCCGAAAACTCCTCCCTCTCAATCGCATTCATCGCGCCTCCCGCTAAGCCGGACGGATGGATCGCGTGGGCTATTAA...

Protein

Download Protein FASTA

478 aa · LXL04_000785|LXL04_000785|OH1004|PROTEIN

MAFLNRNPSLCVLVLIFASLVFLTSPVHSLNCSSQKFTNSKLYSKCIDLPTLGASLHWTHIAENSSLSIAFIAPPAKPDGWIAWAINPTQTGMAGSQALVAFKDSNGSMAVKTYNISSYSSIVEGKISLDVSESIAEYSDKSMKIFATVKLPKTMTEVNHVWQVGGLVKGGMPGKHEFLPANLKSMGKLQLPMSENAQSNGTTTVGSPSIAPSTSITTSITPSLSPRPTNSASRNTVMYALFLLVIMSCNGQIVVLSGVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000785`
TK1151 ID	TkA01G588310
OH-1004 ID	LXL04_000785
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.500
Protein coverage (%)	TK1151 97.490 / OH-1004 51.464 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000785

Location Chr01:14373316-14376081 (-)

Description Similar to ALP1: Protein ANTAGONIST OF LIKE HETEROCHROMATIN PROTEIN 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63270`	Transposase-derived protein that may have nuclease activity (Probable).	Kicking against the PRCs - A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is an Accessory Component of Polycomb Repressive Complex 2.2015 · DOI: 10.1371/journal.pgen.1005660
`At3g55350`	Transposase-derived protein that may have nuclease activity.	No verified direct reference in this release
`At3g25290`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release
`At3g07390`	One-heme-containing cytochrome.	Auxin-responsive genes AIR12 code for a new family of plasma membrane b-type cytochromes specific to flowering plants.2009 · DOI: 10.1104/pp.109.139170
`At4g12980`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000785 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0030198 extracellular matrix organization Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0080022 primary root development Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07390

ath:AT3G25290

ath:AT3G55350

ath:AT3G63270

ath:AT4G12980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.434

Rank 1 · LXL04_000785 · OH-1004

Extracellular0.204

Rank 2 · LXL04_000785 · OH-1004

Endoplasmic reticulum0.134

Rank 3 · LXL04_000785 · OH-1004

Cytoplasm0.084

Rank 4 · LXL04_000785 · OH-1004

Golgi apparatus0.082

Rank 5 · LXL04_000785 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04526.19DUF56893-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000785	`PF04526.19`	DUF568	93	191	5.2e-32	111.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94K49`	Arabidopsis thaliana	Protein ANTAGONIST OF LIKE HETEROCHROMATIN PROTEIN 1	76.382%	Swiss-Prot	weak database homology
`Q9M2U3`	Arabidopsis thaliana	Protein ALP1-like	54.082%	Swiss-Prot	weak database homology
`Q9LSE7`	Arabidopsis thaliana	Cytochrome b561 and DOMON domain-containing protein At3g25290	50.000%	Swiss-Prot	weak database homology
`Q94BT2`	Arabidopsis thaliana	Auxin-induced in root cultures protein 12	44.105%	Swiss-Prot	weak database homology
`Q9SV71`	Arabidopsis thaliana	Cytochrome b561 and DOMON domain-containing protein At4g12980	50.617%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card