LXL04_000691 | RubberDandelionOmics

Gene overview

LXL04_000691

Reference: OH-1004 Chr: Chr01 Coordinates: 12748487-12749264 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

468 bp · LXL04_000691|LXL04_000691|OH1004|cDNA

ATGGTCTTATCCCCCGATATGAGTTCACCCCGGCGACCGCAGGCGCGTGCGCGCGTAAATTCCTCGTCGGAGACTCATCGATCGGATGTGCAATCGGGAAGTTTAGAGTCGTCGTTGCTCCGGCTCGTCAATGATCATCAGAATACCGCTTTACGACTTCGAGAACACACAGAGAAATCGAAGAAAGAAGCGATCAAGAGCGCTTCTCGGGTATCGGATCTGTTAGTGGAGGCTGTTAATGGAGATGTGGAAGAATGTTT...

CDS

Download CDS FASTA

468 bp · LXL04_000691|LXL04_000691|OH1004|CDS

ATGGTCTTATCCCCCGATATGAGTTCACCCCGGCGACCGCAGGCGCGTGCGCGCGTAAATTCCTCGTCGGAGACTCATCGATCGGATGTGCAATCGGGAAGTTTAGAGTCGTCGTTGCTCCGGCTCGTCAATGATCATCAGAATACCGCTTTACGACTTCGAGAACACACAGAGAAATCGAAGAAAGAAGCGATCAAGAGCGCTTCTCGGGTATCGGATCTGTTAGTGGAGGCTGTTAATGGAGATGTGGAAGAATGTTT...

Protein

Download Protein FASTA

155 aa · LXL04_000691|LXL04_000691|OH1004|PROTEIN

MVLSPDMSSPRRPQARARVNSSSETHRSDVQSGSLESSLLRLVNDHQNTALRLREHTEKSKKEAIKSASRVSDLLVEAVNGDVEECFVNEKRIEVEIRALKTTIKRFAKQTDLWLASTHAINNAIKEIGDFENWMKTMELDCKSITAAISNIHQS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000691`
TK1151 ID	TkA01G593430
OH-1004 ID	LXL04_000691
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 96.129 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000691

Location Chr01:12748487-12749264 (-)

Description Similar to BLOS1: Biogenesis of lysosome-related organelles complex 1 subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30330`	Component of the biogenesis of lysosome-related organelles complex-1 (BLOC-1), a complex that mediates the vacuolar degradative transport via the intracellular vesicle trafficking from the endosome to the vacuole.	BLOS1, a putative BLOC-1 subunit, interacts with SNX1 and modulates root growth in Arabidopsis.2010 · DOI: 10.1242/jcs.069732

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000691 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009060 aerobic respiration Biological Process

GO:0016197 endosomal transport Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0032418 lysosome localization Biological Process

GO:0032438 melanosome organization Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

GO:0048364 root development Biological Process

GO:0051036 regulation of endosome size Biological Process

GO:0060155 platelet dense granule organization Biological Process

GO:0062196 regulation of lysosome size Biological Process

GO:0072384 organelle transport along microtubule Biological Process

GO:0005615 extracellular space Cellular Component

KEGG gene cross-reference

ath:AT2G30330

hsa:2647

mmu:14533

pon:100190807

xtr:779698

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.721

Rank 1 · LXL04_000691 · OH-1004

Nucleus0.290

Rank 2 · LXL04_000691 · OH-1004

Cell membrane0.065

Rank 3 · LXL04_000691 · OH-1004

Lysosome / Vacuole0.060

Rank 4 · LXL04_000691 · OH-1004

Golgi apparatus0.053

Rank 5 · LXL04_000691 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06320.19GCN5L142-154 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000691	`PF06320.19`	GCN5L1	42	154	1.7e-39	135.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22929`	Arabidopsis thaliana	Biogenesis of lysosome-related organelles complex 1 subunit 1	68.421%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card