LXL04_000643 | RubberDandelionOmics

Gene overview

LXL04_000643

Reference: OH-1004 Chr: Chr01 Coordinates: 11741133-11742587 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

736 bp · LXL04_000643|LXL04_000643|OH1004|cDNA

AACCCTCACGACTGGCCGCCGTTCTGCCTCCAGAAGCTCCGATTTCGTTTCTACTCGCTATACAACACACAGGCTTTTTCGATCTCTGCCGTCTTCAACTTCAATGGCAAGCAACGATCCAGAGCACAAGGAGGAGGAAACCGCCGCAGCCGAAGACGAAGACACTGGAGCACAGATCGCTCCGATCGTTAAGCTTGAAGAAGTCGCTGTCACTACTGgcgaagaagatgaagatgctATTCTCGATCTTAAAGCCAAGT...

CDS

Download CDS FASTA

651 bp · LXL04_000643|LXL04_000643|OH1004|CDS

CTGCCGTCTTCAACTTCAATGGCAAGCAACGATCCAGAGCACAAGGAGGAGGAAACCGCCGCAGCCGAAGACGAAGACACTGGAGCACAGATCGCTCCGATCGTTAAGCTTGAAGAAGTCGCTGTCACTACTGGCGAAGAAGATGAAGATGCTATTCTCGATCTTAAAGCCAAGTTATATCGGTTTGATAAGGATGGAAACCAGTGGAAGGAACGAGGCGCTGGTTCAGTTAGGTTTTTAAAACACAAACAAACTGGAAA...

Protein

Download Protein FASTA

216 aa · LXL04_000643|LXL04_000643|OH1004|PROTEIN

MPSSTSMASNDPEHKEEETAAAEDEDTGAQIAPIVKLEEVAVTTGEEDEDAILDLKAKLYRFDKDGNQWKERGAGSVRFLKHKQTGKVRLVMRQSKTLKICANHLVIPTMSVQEHAGNDKSCVWHAADFSDGELKDELFCIRFGSVDNCKKFMETFTEVAESQKEKEENKDASDAAGLLENLKVEDKKEEVKEKEEVTEVTTEKAEEKKEVEASST

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000643`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000643

Location Chr01:11741133-11742587 (+)

Description Similar to RANBP1B: Ran-binding protein 1 homolog b

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30060`	Ran-binding protein 1 homolog b.	No verified direct reference in this release
`At5g58590`	Ran-binding protein 1 homolog c.	No verified direct reference in this release
`At1g07140`	Ran-binding protein 1 homolog a.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000643 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006606 protein import into nucleus Biological Process

GO:0007051 spindle organization Biological Process

GO:0007165 signal transduction Biological Process

GO:0015031 protein transport Biological Process

GO:0046604 positive regulation of mitotic centrosome separation Biological Process

GO:0051028 mRNA transport Biological Process

GO:0051168 nuclear export Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G07140

ath:AT2G30060

ath:AT5G58590

hsa:5902

mmu:19385

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.674

Rank 1 · LXL04_000643 · OH-1004

Nucleus0.320

Rank 2 · LXL04_000643 · OH-1004

Cell membrane0.219

Rank 3 · LXL04_000643 · OH-1004

Golgi apparatus0.085

Rank 4 · LXL04_000643 · OH-1004

Mitochondrion0.075

Rank 5 · LXL04_000643 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00638.25Ran_BP142-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000643	`PF00638.25`	Ran_BP1	42	159	1.1e-40	139.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWG8`	Arabidopsis thaliana	Ran-binding protein 1 homolog b	75.000%	Swiss-Prot	strong database homology
`P92985`	Arabidopsis thaliana	Ran-binding protein 1 homolog c	74.176%	Swiss-Prot	strong database homology
`Q9LMK7`	Arabidopsis thaliana	Ran-binding protein 1 homolog a	77.901%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card