LXL04_000496 | RubberDandelionOmics

Gene overview

LXL04_000496

Reference: OH-1004 Chr: Chr01 Coordinates: 9046999-9051241 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3234 bp · LXL04_000496|LXL04_000496|OH1004|cDNA

ATGTTCGTTGCTTCGAAATTTCGATATTGTCTGCTAATTTTTTCTAATCAAGTTCAGTTTTTTGTTTGCAGACGGAAAGACAGTACAGACAAATCATCACTGGATCGCAACCAATATGCTGCCTGGGCAAAGGACGTTCATGAATGTGAACAAAACTACCAGGTAGACAGCAAATCCGGTCTATCTGATAGTGAAGTAGAGAAGCGGCTGAAAAAGTATGGCACAAACGAGTTGGAAAAGCATGAAGGACAATCTGtttt...

CDS

Download CDS FASTA

3234 bp · LXL04_000496|LXL04_000496|OH1004|CDS

ATGTTCGTTGCTTCGAAATTTCGATATTGTCTGCTAATTTTTTCTAATCAAGTTCAGTTTTTTGTTTGCAGACGGAAAGACAGTACAGACAAATCATCACTGGATCGCAACCAATATGCTGCCTGGGCAAAGGACGTTCATGAATGTGAACAAAACTACCAGGTAGACAGCAAATCCGGTCTATCTGATAGTGAAGTAGAGAAGCGGCTGAAAAAGTATGGCACAAACGAGTTGGAAAAGCATGAAGGACAATCTGTTTT...

Protein

Download Protein FASTA

1077 aa · LXL04_000496|LXL04_000496|OH1004|PROTEIN

MFVASKFRYCLLIFSNQVQFFVCRRKDSTDKSSLDRNQYAAWAKDVHECEQNYQVDSKSGLSDSEVEKRLKKYGTNELEKHEGQSVFRLILDQFNDTLVRILLAAAVISFVLAWYDGEEGGEMEITAFVEPLVIFLILIVNAIVGVWQESNAEKALEALKEIQSQQATVIRNGRKLSSLPAKELVPGDIVELRVGDKIPADLRVITLISSTLRVEQGSLTGESEAVSKTTKPVPEETDIQGKKCMVFAGTTVVNGHCLCM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000496`
TK1151 ID	TkA01G608510
OH-1004 ID	LXL04_000496
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 99.153 / OH-1004 97.772 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000496

Location Chr01:9046999-9051241 (-)

Description Similar to ECA1: Calcium-transporting ATPase 1, endoplasmic reticulum-type

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07810`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the endoplasmic reticulum lumen.	No verified direct reference in this release
`At1g07670`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to an endomembrane compartment.	No verified direct reference in this release
`At4g00900`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to an endomembrane compartment.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000496 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0010042 response to manganese ion Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005388 P-type calcium transporter activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G07670

ath:AT1G07810

ath:AT4G00900

sly:543554

tgo:TGME49_230420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.397

Rank 1 · LXL04_000496 · OH-1004

Cell membrane0.225

Rank 2 · LXL04_000496 · OH-1004

Golgi apparatus0.177

Rank 3 · LXL04_000496 · OH-1004

Cytoplasm0.108

Rank 4 · LXL04_000496 · OH-1004

Lysosome / Vacuole0.099

Rank 5 · LXL04_000496 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00690.32Cation_ATPase_N42-109 aa

PF00122.26E1-E2_ATPase162-277 aa

PF13246.13Cation_ATPase452-651 aa

PF00702.33Hydrolase640-760 aa

PF12710.14HAD647-757 aa

PF08282.19Hydrolase_3734-789 aa

PF00689.27Cation_ATPase_C832-1057 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000496	`PF00690.32`	Cation_ATPase_N	42	109	3e-21	75.6
LXL04_000496	`PF00122.26`	E1-E2_ATPase	162	277	3.9e-25	88.3
LXL04_000496	`PF13246.13`	Cation_ATPase	452	651	4.2e-39	134.9
LXL04_000496	`PF00702.33`	Hydrolase	640	760	4.3e-18	67.1
LXL04_000496	`PF12710.14`	HAD	647	757	1.6e-06	29.3
LXL04_000496	`PF08282.19`	Hydrolase_3	734	789	8.3e-07	29.7
LXL04_000496	`PF00689.27`	Cation_ATPase_C	832	1057	2e-47	162.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92939`	Arabidopsis thaliana	Calcium-transporting ATPase 1, endoplasmic reticulum-type	79.353%	Swiss-Prot	strong database homology
`Q9XES1`	Arabidopsis thaliana	Calcium-transporting ATPase 4, endoplasmic reticulum-type	78.483%	Swiss-Prot	strong database homology
`O23087`	Arabidopsis thaliana	Calcium-transporting ATPase 2, endoplasmic reticulum-type	64.340%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card