LXL04_000190 | RubberDandelionOmics

Gene overview

LXL04_000190

Reference: OH-1004 Chr: Chr01 Coordinates: 3848198-3850081 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1101 bp · LXL04_000190|LXL04_000190|OH1004|cDNA

ATGGCGAAAGAGGGACCTAGTTGGGACGGTTTGCTCAAGTGGAGTATTGCTCATTCCGATGGCACTGGAACTACTAGAAAATTAAGTGAGGATGATCGGAAATGGTTCATGGAAGCTATGCAAGCTCAAACCATAGATGTGGTTAAACGAATGAAAGAAATAACTCTTGTGATGAAAACTCCCGATAATATCCTGGAGGAACAAGGCGTAACTGCAACAGATCTTGAAGATATGTTGGATGAACTTCAAGAGCATGTCGA...

CDS

Download CDS FASTA

1101 bp · LXL04_000190|LXL04_000190|OH1004|CDS

ATGGCGAAAGAGGGACCTAGTTGGGACGGTTTGCTCAAGTGGAGTATTGCTCATTCCGATGGCACTGGAACTACTAGAAAATTAAGTGAGGATGATCGGAAATGGTTCATGGAAGCTATGCAAGCTCAAACCATAGATGTGGTTAAACGAATGAAAGAAATAACTCTTGTGATGAAAACTCCCGATAATATCCTGGAGGAACAAGGCGTAACTGCAACAGATCTTGAAGATATGTTGGATGAACTTCAAGAGCATGTCGA...

Protein

Download Protein FASTA

366 aa · LXL04_000190|LXL04_000190|OH1004|PROTEIN

MAKEGPSWDGLLKWSIAHSDGTGTTRKLSEDDRKWFMEAMQAQTIDVVKRMKEITLVMKTPDNILEEQGVTATDLEDMLDELQEHVESIDMANDLHSIGGLTPLLNYLKNSHANIRAKAAEVVSTIVQNNPKSQQLVMEANGMEPLLSKFTSDDDVTVRTKALGAISSLIRHNKPGIQAFRLSNGYSALKDALSSDNVRFQRKALNLIQYLLQENPSDCNVVTELGFPRIMRHLAGSEDPEVREGALSGLHELSKVEIRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000190`
TK1151 ID	TkA01G628440
OH-1004 ID	LXL04_000190
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 96.089 / OH-1004 95.355 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_000190`
Location	Chr01:3848198-3850081 (+)
Description	Similar to FES1: Hsp70 nucleotide exchange factor FES1 (Ustilago maydis (strain 521 / FGSC 9021)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000190` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006417 regulation of translation Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0071629 cytoplasm protein quality control by the ubiquitin-proteasome system Biological Process GO:0005615 extracellular space Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function GO:0031625 ubiquitin protein ligase binding Molecular Function GO:0140313 molecular sequestering activity Molecular Function
KEGG gene cross-reference	afm:AFUA_6G04750 ani:ANIA_06543 mmu:66245 pno:SNOG_01140 uma:UMAG_11735 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.678

Rank 1 · LXL04_000190 · OH-1004

Nucleus0.451

Rank 2 · LXL04_000190 · OH-1004

Peroxisome0.096

Rank 3 · LXL04_000190 · OH-1004

Mitochondrion0.080

Rank 4 · LXL04_000190 · OH-1004

Endoplasmic reticulum0.057

Rank 5 · LXL04_000190 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08609.17Fes19-95 aa

PF16782.12SIL169-216 aa

PF28415.2SIL1_FES1_HPBP1_C92-215 aa

PF13513.13HEAT_EZ115-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000190	`PF08609.17`	Fes1	9	95	2.3e-13	51.7
LXL04_000190	`PF16782.12`	SIL1	69	216	5.4e-07	29.9
LXL04_000190	`PF28415.2`	SIL1_FES1_HPBP1_C	92	215	9.2e-16	58.7
LXL04_000190	`PF13513.13`	HEAT_EZ	115	169	4.6e-06	27.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card