RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_000063
Reference: OH-1004 Chr: Chr01 Coordinates: 1421394-1423696 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

768 bp · LXL04_000063|LXL04_000063|OH1004|cDNA

ATGGGTTCGACTCGATCCGATCATGGCTCCGGGAAAGAGCGATTGAAATGGACTCAAGAACTCCATGATTTGTTCGAAAAGGCAGTTACTCAGCTTGGAGGTCCTGATCGTGCAACACCTAAGGGTATATTAAAGGCCATGGGGATCACAGGGCTTACTATTTACCATGTTAAAAGCCACTTACAGAAATATAGAATGTCGAAATTTGTTCCGGAAACATCGAGAAGAGAAAGGTTTGAAAAAAGAAGCATATCTGAACT...

CDS

Download CDS FASTA

768 bp · LXL04_000063|LXL04_000063|OH1004|CDS

ATGGGTTCGACTCGATCCGATCATGGCTCCGGGAAAGAGCGATTGAAATGGACTCAAGAACTCCATGATTTGTTCGAAAAGGCAGTTACTCAGCTTGGAGGTCCTGATCGTGCAACACCTAAGGGTATATTAAAGGCCATGGGGATCACAGGGCTTACTATTTACCATGTTAAAAGCCACTTACAGAAATATAGAATGTCGAAATTTGTTCCGGAAACATCGAGAAGAGAAAGGTTTGAAAAAAGAAGCATATCTGAACT...

Protein

Download Protein FASTA

255 aa · LXL04_000063|LXL04_000063|OH1004|PROTEIN

MGSTRSDHGSGKERLKWTQELHDLFEKAVTQLGGPDRATPKGILKAMGITGLTIYHVKSHLQKYRMSKFVPETSRRERFEKRSISELFPNFSVTSGAQLNEALQMQMEVQRRLSDQLEVQKNLKLKIEAQSKFLEKLSQEHKTSKPNFTKINKGITSPTSLPSLCDVSESIMKDLESDSDDVDANEMQPKRLRVDEDHDLIPSTQRLKPSSTLNTYNIHLPKSGTPFPPQDNNIFPWSSAFCQSPLVPTWFNSFG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_000063
TK1151 IDTkA01G637910
OH-1004 IDLXL04_000063
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)98.400
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_000063
LocationChr01:1421394-1423696 (-)
DescriptionSimilar to PHL7: Myb family transcription factor PHL7
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g01060 Myb family transcription factor PHL7. No verified direct reference in this release
At4g28610 Transcription factor involved in phosphate starvation signaling.
The Arabidopsis transcription factor PHR1 is essential for adaptation to high light and retaining functional photosynthesis during phosphate starvation.2012 · DOI: 10.1111/j.1399-3054.2011.01520.x
At5g06800 Myb family transcription factor PHL5. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0665600 Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression.
An SPX-RLI1 Module Regulates Leaf Inclination in Response to Phosphate Availability in Rice.2018 · DOI: 10.1105/tpc.17.00738
Modulation of nitrate-induced phosphate response by the MYB transcription factor RLI1/HINGE1 in the nucleus.2021 · DOI: 10.1016/j.molp.2020.12.005
UniProt: A2XYN9 Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression (By similarity). No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000063 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0007623 circadian rhythm Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0010167 response to nitrate Biological Process
GO:0010468 regulation of gene expression Biological Process
GO:0010966 regulation of phosphate transport Biological Process
GO:0016036 cellular response to phosphate starvation Biological Process
GO:0016132 brassinosteroid biosynthetic process Biological Process
GO:0034765 regulation of monoatomic ion transmembrane transport Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0048768 root hair cell tip growth Biological Process
KEGG gene cross-reference
ath:AT2G01060
ath:AT4G28610
ath:AT5G06800
dosa:Os04g0665600
osa:4337318
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949
Rank 1 · LXL04_000063 · OH-1004
Cytoplasm0.170
Rank 2 · LXL04_000063 · OH-1004
Mitochondrion0.023
Rank 3 · LXL04_000063 · OH-1004
Cell membrane0.015
Rank 4 · LXL04_000063 · OH-1004
Endoplasmic reticulum0.007
Rank 5 · LXL04_000063 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding14-65 aa
PF14379.12Myb_CC_LHEQLE98-140 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_000063PF00249.38Myb_DNA-binding14654.9e-1040.1
LXL04_000063PF14379.12Myb_CC_LHEQLE981402.4e-1866.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SJW0Arabidopsis thalianaMyb family transcription factor PHL747.126%Swiss-Protmoderate database homology
Q94CL7Arabidopsis thalianaProtein PHOSPHATE STARVATION RESPONSE 140.865%Swiss-Protmoderate database homology
Q0WVU3Arabidopsis thalianaMyb family transcription factor PHL542.308%Swiss-Protmoderate database homology
Q0J995Oryza sativa subsp. japonicaMyb family transcription factor RLI153.788%Swiss-Protmoderate database homology
A2XYN9Oryza sativa subsp. indicaMyb family transcription factor RLI153.788%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser