TkA08G242910 | RubberDandelionOmics

Gene overview

TkA08G242910

Reference: TK1151 Chr: Chr08 Coordinates: 63417089-63419849 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2149 bp · TkA08G242910|TK1151|cDNA

AAAAAGGTTGAAAGGGACGACATCTTCTTGATTTTATAATCTTTTGTTTATTGCTTCCTCTTCACTTTCCTTCCCCCATCTTTTTCCAACTTTCTTCCCCTTTTTTTTCTTTCTGCTTTTCTGTTATTACCCAACTGCTCTCCAACACAACCCCTTTATCTTTCACATACTCGAATTGAGTGACTTTCAAGAACCAACAACATTATTAAGTCTCCAATCCCCCTTCCTTAATTCCCTCAAAAACACACACACCCATTTCG...

CDS

Download CDS FASTA

1593 bp · TkA08G242910|TK1151|CDS

ATGGAAAAAGACGGCTTCTTTAGCAATGAAGGTAATGGGATTCCGCAATCCTGGAACTCAATCTTCGGAATGGATATGGAAAGTCAAGTTAACGAGCTGAATTGTAGCTCAGAACAGATTCCCAATTGCTTTTTCAACCGCAATTGGGACAATTCAATGGATCAGAGCGATCCCTTTGAATCCGCCTTGAGTTCCATTGTTTCATCTCCAGTGAATTCTCATCCTGGGATCCCAATTCCGGGTTGTGGTGGTGATAACGT...

Protein

Download Protein FASTA

530 aa · TkA08G242910|TK1151|PROTEIN

MEKDGFFSNEGNGIPQSWNSIFGMDMESQVNELNCSSEQIPNCFFNRNWDNSMDQSDPFESALSSIVSSPVNSHPGIPIPGCGGDNVVLKELIGRLGSICNSGEISPQSCIQGNNSANTSCYNTPLNSPPKLNLSIMDHHHQIQGNLPIPRNHQLPLSPFPADPGFVERAARYSCFGGKKEPEFPHMVESGMLSRASSNQSFKTTGSQFVGIQEEKNGMPVPASDKKFSRLSMSLTSENKELDNSMEESSLSEQIPGGEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G242910`
TK1151 ID	TkA08G242910
OH-1004 ID	LXL04_033230
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G242910

Location Chr08:63417089-63419849 (+)

Description Similar to BHLH62: Transcription factor bHLH62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07340`	Transcription factor bHLH62.	No verified direct reference in this release
`At5g48560`	Transcription factor that binds DNA to G box 5'-CACGTG-3' and to E-box 5'-CANNTG-3' (By similarity).	Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861
`At3g23690`	Transcription factor bHLH77.	No verified direct reference in this release
`At1g68920`	Transcriptional activator involved in cell elongation.	No verified direct reference in this release
`At1g10120`	Transcriptional activator involved in cell elongation.	Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033230 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009637 response to blue light Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G26260

ath:AT1G68920

ath:AT3G07340

ath:AT3G23690

ath:AT5G48560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976

Rank 1 · TkA08G242910 · TK1151

Cytoplasm0.099

Rank 2 · TkA08G242910 · TK1151

Cell membrane0.024

Rank 3 · TkA08G242910 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA08G242910 · TK1151

Plastid0.009

Rank 5 · TkA08G242910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28211GlpR278-382 aa

PF02590SPOUT_MTase324-379 aa

PF23177bHLH_IRO3364-418 aa

PF00010HLH365-412 aa

PF23173bHLH_SAC51370-414 aa

PF23174bHLH_ILI375-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G242910	`PF28211`	GlpR	278	382	5.0	7.8
TkA08G242910	`PF02590`	SPOUT_MTase	324	379	0.31	11.8
TkA08G242910	`PF23177`	bHLH_IRO3	364	418	0.012	16.7
TkA08G242910	`PF00010`	HLH	365	412	8.8e-07	29.4
TkA08G242910	`PF23173`	bHLH_SAC51	370	414	2.6e-06	28.0
TkA08G242910	`PF23174`	bHLH_ILI	375	432	0.0028	18.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRT2`	Arabidopsis thaliana	sp\|Q9SRT2\|BH062_ARATH Transcription factor bHLH62	38.700%	Swiss-Prot	Medium
`Q9FJL4`	Arabidopsis thaliana	sp\|Q9FJL4\|BH078_ARATH Transcription factor bHLH78	46.200%	Swiss-Prot	Medium
`Q9LK48`	Arabidopsis thaliana	sp\|Q9LK48\|BH077_ARATH Transcription factor bHLH77	51.100%	Swiss-Prot	Low
`Q9CAA9`	Arabidopsis thaliana	sp\|Q9CAA9\|BH049_ARATH Transcription factor bHLH49	56.800%	Swiss-Prot	Low
`Q6NKN9`	Arabidopsis thaliana	sp\|Q6NKN9\|BH074_ARATH Transcription factor bHLH74	50.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card