Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1695 bp · TkA08G192750|TK1151|cDNA
AATAGAGCAACCTAATTGTGATTATTAGTTTCGTAAAGTAACACATTTGTTCCCAAAGCAGTTTTTATACGAAACCTGAAACCCTTCCTTGTTTCCCCCTCACCTCCACGCTCTTCTCTACGCAATTGGTCTGATCGACGAACTATAGAAACCACCAGCAACGTATCCAGTGTCGATCGATTTCCTTGTCCTCGTTTCAAAGACAGTAAATATATAGTGACAGCTGAACTTTCTCTGCTGATGTTCTAAGACTAAATTTC...
1053 bp · TkA08G192750|TK1151|CDS
ATGGTGACCGCAGGTTCGAATAACCAAGATGAGATTATTGGGGATAAACATCCATCATCAGCTGTTTCTAGAGGAGGCGGAGCGACGCGGTCCTGGGGCACCACAGCCTCGGGTCAATCCGTTTCGACAAGTGGCAGTGTTGGGTCTCCTTCGACCCGGAGTGAGGCTACCATGGCGGTTACGCCCGCTAGTGAGAACACATTTTTGAGGCTGAATCACCTTGATATTCATACTGATAATGCTGGATCTCAAGTGCCTGC...
Protein
Download Protein FASTA350 aa · TkA08G192750|TK1151|PROTEIN
MVTAGSNNQDEIIGDKHPSSAVSRGGGATRSWGTTASGQSVSTSGSVGSPSTRSEATMAVTPASENTFLRLNHLDIHTDNAGSQVPAVNKKKKRAQRATGGDKGGRGLRQFSMKVCEKVESKGRTTYNEVADELVAEFADPGDGGQTPDQQQYDEKNIRRRVYDALNVLMAMDIISKDKKEIQWKGLPRSTLNDIEEIKGERLAIRNRIEKKTAYLKELQDQYVGLQNLIQRNEELYSSGNVPSGGVALPFILVQTRPHA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G192750 |
|---|---|
| TK1151 ID | TkA08G192750 |
| OH-1004 ID | LXL04_005134 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 82.600 |
| Protein coverage (%) | TK1151 86.571 / OH-1004 86.080Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G192750 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:50393524-50396086 (-) | |||||||||
| Description | Similar to DPB: Transcription factor-like protein DPB | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000082 G1/S transition of mitotic cell cycle Biological Process GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006366 transcription by RNA polymerase II Biological Process GO:0031507 heterochromatin formation Biological Process GO:0042023 DNA endoreduplication Biological Process GO:0045892 negative regulation of DNA-templated transcription Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0051726 regulation of cell cycle Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT5G02470 ath:AT5G03415 bta:534579 hsa:7027 mmu:21781 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02319WHD_E2F_TDP106-186 aaPF08781DP194-303 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G192750 | PF02319 | WHD_E2F_TDP | 106 | 186 | 2.2e-19 | 69.6 |
| TkA08G192750 | PF08781 | DP | 194 | 303 | 1.2e-38 | 132.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.