TkA08G153160 | RubberDandelionOmics

Gene overview

TkA08G153160

Reference: TK1151 Chr: Chr08 Coordinates: 39963697-39966494 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1519 bp · TkA08G153160|TK1151|cDNA

CAAAAAGGCAAAACAGAAAAAGTGTTGACTGGGCCGGAATGTGGGATTTGTTCCAGACAATTACATCATTGCTGCTTCATCCTTAATTCCCTCTTTATACTATTAAATCATTATACGAATTCTCAGACACCTTTTGTCTGAAAACCTGATTAACAACTGTTTTCTGATCGAAGTTCAGGTGCCAGTGTGATTCCAAACATCCTTCCGATCACATCCATGGCTAATTCACCTGAATCATCGCGCCATATACCCTCAGATTT...

CDS

Download CDS FASTA

1119 bp · TkA08G153160|TK1151|CDS

ATGGCTAATTCACCTGAATCATCGCGCCATATACCCTCAGATTTCCGTGCTCCACCACCGTCTCCAGTTGCATCTGCCCGTCGATCCTCCGTCGCTAACGATGAGGTGCTCACAGAGTTTCTCCGCTCGCTTCACGTACCTGACCTTGTTTTGCCGGATCGGGCGTTTCCTCGTCAAAATCCGAAGATCCAGAGCTTACCGAAACTTGATTTTGGAGCCGCAAACGTTTTTGATTTTTCGAAGGATCGTGGTTTTGAGGA...

Protein

Download Protein FASTA

372 aa · TkA08G153160|TK1151|PROTEIN

MANSPESSRHIPSDFRAPPPSPVASARRSSVANDEVLTEFLRSLHVPDLVLPDRAFPRQNPKIQSLPKLDFGAANVFDFSKDRGFEEVIEVIAKTGCFELVNHGIPDRVLSSVVNSGAGVFQLAPEKKAVVSRSADRPYGFVEFHGDEKELVEEFVWCRDESLKTEMEEIWPIQYSNFSEKMENLMSEIENISQILLKLFVGSTTPKSSLEDYETREKEIDGSICYIYKHYQNADSVSNDQQYMDSLRYDVIRMLIRGSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G153160`
TK1151 ID	TkA08G153160
OH-1004 ID	LXL04_032154
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G153160

Location Chr08:39963697-39966494 (-)

Description Similar to GA2OX4: Gibberellin 2-beta-dioxygenase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0536400`	Catalyzes the 3-beta-hydroxylation of 2S-flavanones to 2R,3R- dihydroflavonols which are intermediates in the biosynthesis of flavonols, anthocyanidins, catechins and proanthocyanidins in plants.	Flavanone 3beta-hydroxylases from rice: key enzymes for favonol and anthocyanin biosynthesis.2008 · DOI: 10.1016/s1016-8478(23)17587-x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032154 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009835 fruit ripening Biological Process

GO:0010114 response to red light Biological Process

GO:0042617 paclitaxel biosynthetic process Biological Process

GO:0045487 gibberellin catabolic process Biological Process

GO:0071398 cellular response to fatty acid Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G30040

ath:AT1G47990

cmo:103491357

dosa:Os04g0667400

osa:4337327

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.599

Rank 1 · TkA08G153160 · TK1151

Cytoplasm0.371

Rank 2 · TkA08G153160 · TK1151

Cell membrane0.077

Rank 3 · TkA08G153160 · TK1151

Endoplasmic reticulum0.054

Rank 4 · TkA08G153160 · TK1151

Plastid0.039

Rank 5 · TkA08G153160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14226DIOX_N67-149 aa

PF031712OG-FeII_Oxy273-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G153160	`PF14226`	DIOX_N	67	149	6.9e-07	30.7
TkA08G153160	`PF03171`	2OG-FeII_Oxy	273	334	4.8e-07	30.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W2X5`	Oryza sativa subsp. japonica	sp\|Q8W2X5\|FL3H2_ORYSJ Flavanone 3-dioxygenase 2	23.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card