Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1811 bp · TkA08G149810|TK1151|cDNA
GAAACATTAGGGACCATCACCGAGAAAGAAAAGGCCGAGCTCTGGACACTATAAAACCAAGCAATGCCTCAACGACAGCCTTGCGCCTAGCCCTACTATATACGCATAGATTTATATCGTAGTATTAATAATAATTATCCCTTTTTCCTGTAATTTTGATTCACGTAAGTAGTTTGATCTATTGTTCGTTGATGTTGGGGTTAGGAGGTGTGGATTCATCAGACAGAAGCGATCAGAAAGTTCAAAAATTAGGTTTCCCA...
999 bp · TkA08G149810|TK1151|CDS
ATGGATAAGAAGAAAGTGGCGGTCCCTCTCGTATGCCATGGTCATTCTCGCCCGGTGGTGGATTTGTTTTACAGTCCGATTACTCCAGATGGGTTTTTCCTCATCAGCGCCAGCAAGGATTCCACTCCTATGCTCAGAAATGGAGAAACTGGTGATTGGATAGGAACATTTGAAGGCCACAAAGGTGCAGTATGGAGTTGCTGTTTGGACACAAACGCCCTTCGTGCTGCTTCAGCCTCTGCTGATTTCTCTGCAAAAAT...
Protein
Download Protein FASTA332 aa · TkA08G149810|TK1151|PROTEIN
MDKKKVAVPLVCHGHSRPVVDLFYSPITPDGFFLISASKDSTPMLRNGETGDWIGTFEGHKGAVWSCCLDTNALRAASASADFSAKIWDALTGDVLHSFDHKHIVRACSFSEDTHLLLTGGFEKILRIFDLNRPDAPPREVENSPGSVRTVAWLHSDQTILSSCSDSGGVRLWDVRSGKIVNTLETKSSVTSAEVSKDGRYITTADGSSVKFWDANHFGLVKSYDMPCTVESASLEPKFGNKFIAGGEDMWIRLFDFNTG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G149810 |
|---|---|
| TK1151 ID | TkA08G149810 |
| OH-1004 ID | LXL04_032091 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G149810 |
|---|---|
| Location | Chr08:38991317-38994359 (-) |
| Description | Similar to strap: Serine-threonine kinase receptor-associated protein |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0000380 alternative mRNA splicing, via spliceosome Biological Process GO:0000387 spliceosomal snRNP assembly Biological Process GO:0022618 protein-RNA complex assembly Biological Process GO:0030154 cell differentiation Biological Process GO:0030277 maintenance of gastrointestinal epithelium Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0032797 SMN complex Cellular Component GO:0034719 SMN-Sm protein complex Cellular Component GO:0003723 RNA binding Molecular Function |
| KEGG gene cross-reference | bta:510201 ddi:DDB_G0286457 hsa:11171 mmu:20901 rno:297699 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23342WDR90_beta-prop_4th7-67 aaPF24105Beta-prop_CAF1B_HIR18-101 aaPF24805EIF3I9-298 aaPF00400WD4011-42 aaPF23414Beta-prop_EML_211-56 aaPF25460Beta-prop_Aladin11-120 aaPF25172Beta-prop_WDR3_2nd12-130 aaPF25168Beta-prop_WDR36-Utp21_2nd12-42 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G149810 | PF23342 | WDR90_beta-prop_4th | 7 | 67 | 2.9e-09 | 37.2 |
| TkA08G149810 | PF24105 | Beta-prop_CAF1B_HIR1 | 8 | 101 | 1.6e-16 | 61.0 |
| TkA08G149810 | PF24805 | EIF3I | 9 | 298 | 4.7e-47 | 161.4 |
| TkA08G149810 | PF00400 | WD40 | 11 | 42 | 5.9e-39 | 131.6 |
| TkA08G149810 | PF23414 | Beta-prop_EML_2 | 11 | 56 | 2e-21 | 77.3 |
| TkA08G149810 | PF25460 | Beta-prop_Aladin | 11 | 120 | 9.1e-09 | 35.6 |
| TkA08G149810 | PF25172 | Beta-prop_WDR3_2nd | 12 | 130 | 1.5e-23 | 84.1 |
| TkA08G149810 | PF25168 | Beta-prop_WDR36-Utp21_2nd | 12 | 42 | 1.3e-20 | 74.6 |
| TkA08G149810 | PF25175 | Beta-prop_WDR5 | 13 | 225 | 1e-43 | 150.5 |
| TkA08G149810 | PF25173 | Beta-prop_WDR3_1st | 13 | 132 | 3e-35 | 122.3 |
| TkA08G149810 | PF23609 | Beta-prop_EIPR1 | 14 | 46 | 1.2e-05 | 25.6 |
| TkA08G149810 | PF23419 | WD40_RFWD3 | 15 | 72 | 2e-07 | 31.4 |
| TkA08G149810 | PF30151 | PAC11 | 15 | 58 | 1.6e-06 | 27.9 |
| TkA08G149810 | PF24782 | WD40_MABP1-WDR62_2nd | 16 | 210 | 1.6e-12 | 47.7 |
| TkA08G149810 | PF23381 | Beta-prop_IFT122_1st | 22 | 247 | 2.8e-41 | 142.4 |
| TkA08G149810 | PF24817 | WD40_WDHD1_1st | 27 | 100 | 1.6e-29 | 103.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.