Gene Card
Gene overview
cDNA / CDS / Protein Sequences
750 bp · TkA08G101720|TK1151|cDNA
ATGGATACTGATTCGGATTGGGAACCTTCAGAAGGGACAGGTTCGGAAGACACTGGCACAGGTTCGGAAGGAGTTGCTTCGGAAAAGGAGGTGAACTGCGGATTGACGCTCGGAAGACGGAGGAGTTTCGGAATGGTGGGCGATCTCGGAAGGGAATGCAACTTCGGAAAGATGGCTAGTCTCGGAACGGGAAGCAGCTTCGGACCCGGTGGATCGGCGGAAACTTTCCGAAGCATGGCGAAGCTTCGCAGCAGTTCTGG...
750 bp · TkA08G101720|TK1151|CDS
ATGGATACTGATTCGGATTGGGAACCTTCAGAAGGGACAGGTTCGGAAGACACTGGCACAGGTTCGGAAGGAGTTGCTTCGGAAAAGGAGGTGAACTGCGGATTGACGCTCGGAAGACGGAGGAGTTTCGGAATGGTGGGCGATCTCGGAAGGGAATGCAACTTCGGAAAGATGGCTAGTCTCGGAACGGGAAGCAGCTTCGGACCCGGTGGATCGGCGGAAACTTTCCGAAGCATGGCGAAGCTTCGCAGCAGTTCTGG...
Protein
Download Protein FASTA249 aa · TkA08G101720|TK1151|PROTEIN
MDTDSDWEPSEGTGSEDTGTGSEGVASEKEVNCGLTLGRRRSFGMVGDLGRECNFGKMASLGTGSSFGPGGSAETFRSMAKLRSSSGMNSYSDPADLRMLSEALRASELNSCVMASLQTQYFFPRFPPPPPPPPPPPPPPPPPPTATPPSPPHFVSPPPPPPSAPGAHTAIIVVAFVSCGGVFFLAFVMAALWCFFKKKKMVHKVENAHIDEHRKVRESVVQGPRGNESVMISVEDDIRINGRVKGCII
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G101720 |
|---|---|
| TK1151 ID | TkA08G101720 |
| OH-1004 ID | LXL04_031330 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 79.700 |
| Protein coverage (%) | TK1151 29.317 / OH-1004 10.835Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G101720 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:26382077-26383804 (+) | |||||||||
| Description | Similar to KRR1: KRR1 small subunit processome component (Saccharomyces cerevisiae (strain Zymaflore VL3) | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000447 endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0030686 90S preribosome Cellular Component GO:0030688 preribosome, small subunit precursor Cellular Component GO:0032040 small-subunit processome Cellular Component GO:0003723 RNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | sce:YCL059C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16101PRIMA1117-139 aaPF04277OAD_gamma120-175 aaPF16101PRIMA1138-207 aaPF29364TED6171-206 aaPF17870Insulin_TMD171-199 aaPF04277OAD_gamma185-203 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G101720 | PF16101 | PRIMA1 | 117 | 139 | 0.016 | 15.7 |
| TkA08G101720 | PF04277 | OAD_gamma | 120 | 175 | 0.2 | 13.1 |
| TkA08G101720 | PF16101 | PRIMA1 | 138 | 207 | 0.016 | 15.7 |
| TkA08G101720 | PF29364 | TED6 | 171 | 206 | 4.3e-11 | 43.2 |
| TkA08G101720 | PF17870 | Insulin_TMD | 171 | 199 | 0.17 | 12.7 |
| TkA08G101720 | PF04277 | OAD_gamma | 185 | 203 | 0.2 | 13.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.