TkA08G098160 | RubberDandelionOmics

Gene overview

TkA08G098160

Reference: TK1151 Chr: Chr08 Coordinates: 25407666-25408124 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

459 bp · TkA08G098160|TK1151|cDNA

ATGGCTGCCAACAAGTTTGCGACAATGTTGCATAACAACACAAACAAGATCACACTGGTTCTCGTTTATGCTGTTCTTGAATGGATACTGATAGCCCTCCTTCTTCTTAATTCTGTTTTTTCCTATTTAATCATCAAATTTGCCCAGTTTTTTGGTTTAACTCCGCCATGTTTCTGGTGTGCTCGAATTGATAGATTTCTCGAATCTGATGATAATAATTTTCATTACCATCTCTGCGAGCTTCATTCAAAGGAGGTTTC...

CDS

Download CDS FASTA

459 bp · TkA08G098160|TK1151|CDS

ATGGCTGCCAACAAGTTTGCGACAATGTTGCATAACAACACAAACAAGATCACACTGGTTCTCGTTTATGCTGTTCTTGAATGGATACTGATAGCCCTCCTTCTTCTTAATTCTGTTTTTTCCTATTTAATCATCAAATTTGCCCAGTTTTTTGGTTTAACTCCGCCATGTTTCTGGTGTGCTCGAATTGATAGATTTCTCGAATCTGATGATAATAATTTTCATTACCATCTCTGCGAGCTTCATTCAAAGGAGGTTTC...

Protein

Download Protein FASTA

152 aa · TkA08G098160|TK1151|PROTEIN

MAANKFATMLHNNTNKITLVLVYAVLEWILIALLLLNSVFSYLIIKFAQFFGLTPPCFWCARIDRFLESDDNNFHYHLCELHSKEVSHLGFCLIHKKLAESHAMCDDCSSPDLGFQKESRNFVFSKVERINAIQSVGEDEVILKCSCCRVNF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G098160`
TK1151 ID	TkA08G098160
OH-1004 ID	LXL04_011370
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 15.800 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G098160

Location Chr08:25407666-25408124 (-)

Description Similar to MYOB2: Myosin-binding protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16720`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	No verified direct reference in this release
`At1g70750`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	No verified direct reference in this release
`At1g08800`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	Identification of myosin XI receptors in Arabidopsis defines a distinct class of transport vesicles.2013 · DOI: 10.1105/tpc.113.113704

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011370 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0016020 membrane Cellular Component

GO:0030133 transport vesicle Cellular Component

GO:0017022 myosin binding Molecular Function

GO:0080115 myosin XI tail binding Molecular Function

KEGG gene cross-reference

ath:AT1G70750

ath:AT1G74830

ath:AT5G16720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.369

Rank 1 · TkA08G098160 · TK1151

Nucleus0.219

Rank 2 · TkA08G098160 · TK1151

Cytoplasm0.161

Rank 3 · TkA08G098160 · TK1151

Mitochondrion0.160

Rank 4 · TkA08G098160 · TK1151

Golgi apparatus0.137

Rank 5 · TkA08G098160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23676YnaM29-46 aa

PF09996DUF223748-74 aa

PF09996DUF223789-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G098160	`PF23676`	YnaM	29	46	0.17	12.2
TkA08G098160	`PF09996`	DUF2237	48	74	0.15	12.8
TkA08G098160	`PF09996`	DUF2237	89	121	0.15	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WNW4`	Arabidopsis thaliana	sp\|Q0WNW4\|MYOB3_ARATH Myosin-binding protein 3	51.300%	Swiss-Prot	High
`Q9CAC4`	Arabidopsis thaliana	sp\|Q9CAC4\|MYOB2_ARATH Myosin-binding protein 2	47.100%	Swiss-Prot	Medium
`F4HXQ7`	Arabidopsis thaliana	sp\|F4HXQ7\|MYOB1_ARATH Myosin-binding protein 1	35.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card