TkA08G090850 | RubberDandelionOmics

Gene overview

TkA08G090850

Reference: TK1151 Chr: Chr08 Coordinates: 23499589-23506659 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5718 bp · TkA08G090850|TK1151|cDNA

ATTCGACTTAGGACACTTCCCTTTCTCCAAACATTTCAGCAATTTTCTTCTCACTCTTTCTACTTCACGACACTTCCCTTTCTCCTCCCACTCCCTCTCCGGTATGCAAATCTCGTCAGACAGCTTCCCTCCGCCCCTTCTTCTGGTTCTAGGTAAAGTTTTTTTCTTTATGCCCTAAAACTTGATATCAGAGGTTGAAGGGTAAACGCCGACCTCCACTTTTCCATTGATCAAAACTCCAACTTTCCCCTAATTTTGTA...

CDS

Download CDS FASTA

3354 bp · TkA08G090850|TK1151|CDS

ATGGCCGCCACGGTTGCCACCGCCGACGCCGACGGCACCGAGCGTCCTGCTATCCCTCTGGTCTCAGTCCCAACCGTTGATCTCCGCCTCCTCTCCCAATCAGAACTCTACACTCTCTCCATATCGTCGGACTCCTCATTCGATTCCAACCGCTGCAACGAGGTCGTTATCCCCAAAATCAACCGCGCCGTTTTCAATGAGTCCGCCGGTAGCCGTAAACAAACATACTCTCGTTTCCGTCTTGCCTCGGCGGAGTCGTC...

Protein

Download Protein FASTA

1117 aa · TkA08G090850|TK1151|PROTEIN

MAATVATADADGTERPAIPLVSVPTVDLRLLSQSELYTLSISSDSSFDSNRCNEVVIPKINRAVFNESAGSRKQTYSRFRLASAESSSTTTKTTTLHRRTPHLRLAHTHPSNNINDPEQAENSQIIRMLKQFCKSDPNFQDVDQMDDENNSNSVVPEFLNPENLGIKRKRGRPRKHENVVFLRPPTAKRIRHNTVKKAVEYDNEMDRELVNDSGVTVNMATLSGLDDPYGPEIRRRTLGMSTEDELLGFLRGMNGQWGSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G090850`
TK1151 ID	TkA08G090850
OH-1004 ID	LXL04_031166
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G090850

Location Chr08:23499589-23506659 (+)

Description Similar to MBD8: Methyl-CpG-binding domain-containing protein 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01037`	RNA-binding protein involved in group II intron splicing.	No verified direct reference in this release
`At1g22310`	Probable transcriptional regulator (By similarity).	AtMBD8 is involved in control of flowering time in the C24 ecotype of Arabidopsis thaliana.2009 · DOI: 10.1111/j.1399-3054.2009.01218.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0571100`	RNA-binding protein involved in group II intron splicing.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031166 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0008327 methyl-CpG binding Molecular Function

KEGG gene cross-reference

ath:AT1G22310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA08G090850 · TK1151

Cytoplasm0.077

Rank 2 · TkA08G090850 · TK1151

Cell membrane0.026

Rank 3 · TkA08G090850 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA08G090850 · TK1151

Plastid0.012

Rank 5 · TkA08G090850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02178AT_hook167-177 aa

PF01429MBD168-191 aa

PF01429MBD275-320 aa

PF05053Menin345-443 aa

PF29774BB_0097925-943 aa

PF29774BB_0097982-1000 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G090850	`PF02178`	AT_hook	167	177	0.057	14.0
TkA08G090850	`PF01429`	MBD	168	191	6.9e-06	26.3
TkA08G090850	`PF01429`	MBD	275	320	6.9e-06	26.3
TkA08G090850	`PF05053`	Menin	345	443	0.58	9.1
TkA08G090850	`PF29774`	BB_0097	925	943	0.31	11.7
TkA08G090850	`PF29774`	BB_0097	982	1000	0.31	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0MFS5`	Arabidopsis thaliana	sp\|A0MFS5\|WTF1_ARATH Protein WHAT'S THIS FACTOR 1 homolog, chloroplastic	33.700%	Swiss-Prot	Medium
`Q9LME6`	Arabidopsis thaliana	sp\|Q9LME6\|MBD8_ARATH Methyl-CpG-binding domain-containing protein 8	33.100%	Swiss-Prot	Low
`Q65XL5`	Oryza sativa subsp. japonica	sp\|Q65XL5\|WTF1_ORYSJ Protein WHAT'S THIS FACTOR 1 homolog, chloroplastic	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card