TkA08G072300 | RubberDandelionOmics

Gene overview

TkA08G072300

Reference: TK1151 Chr: Chr08 Coordinates: 18660047-18661118 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

681 bp · TkA08G072300|TK1151|cDNA

GGACCAATCAGAACGAAGGAAACACGTCAGGCACCAATAGACCGAGAAACCATAACCAGTAGAGAAGCTCGATCTGCAGCGACTGCTCTAGATACAAATTTGCATATCTATAACTACATCAGAATGCTTTGGAGGAAAGTCTTGTTCATCTGTTTCGTTATTCTGCCAATAACTATCACCACTGCTATTCCAGAATCTTCGGATGCATCTCAGGTCAGATGCAGCAAGCGATGCGTGGCAGAAAACTGTAACTCTCTTGG...

CDS

Download CDS FASTA

552 bp · TkA08G072300|TK1151|CDS

GGACCAATCAGAACGAAGGAAACACGTCAGGCACCAATAGACCGAGAAACCATAACCAGTAGAGAAGCTCGATCTGCAGCGACTGCTCTAGATACAAATTTGCATATCTATAACTACATCAGAATGCTTTGGAGGAAAGTCTTGTTCATCTGTTTCGTTATTCTGCCAATAACTATCACCACTGCTATTCCAGAATCTTCGGATGCATCTCAGGTCAGATGCAGCAAGCGATGCGTGGCAGAAAACTGTAACTCTCTTGG...

Protein

Download Protein FASTA

183 aa · TkA08G072300|TK1151|PROTEIN

GPIRTKETRQAPIDRETITSREARSAATALDTNLHIYNYIRMLWRKVLFICFVILPITITTAIPESSDASQVRCSKRCVAENCNSLGIRYGKYCGVGWTGCPGESPCDDLDACCQIHDECVEKKGMTNVKCHEKFKRCIKKVQKSGKAGFSRDCPINTAVPTMQQGMDMAILFSQFGNSKLEL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G072300`
TK1151 ID	TkA08G072300
OH-1004 ID	LXL04_018614
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 81.967 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G072300

Location Chr08:18660047-18661118 (+)

Description Similar to PLA2-I: Probable phospholipase A2 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19690`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`At4g29460`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`At4g29470`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0831700`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`Os03g0708000`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018614 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006644 phospholipid metabolic process Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009555 pollen development Biological Process

GO:0009630 gravitropism Biological Process

GO:0009733 response to auxin Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0030307 positive regulation of cell growth Biological Process

GO:0050482 arachidonate secretion Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT2G06925

ath:AT2G19690

ath:AT4G29460

ath:AT4G29470

dosa:Os02g0831700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.462

Rank 1 · TkA08G072300 · TK1151

Cytoplasm0.179

Rank 2 · TkA08G072300 · TK1151

Cell membrane0.178

Rank 3 · TkA08G072300 · TK1151

Golgi apparatus0.127

Rank 4 · TkA08G072300 · TK1151

Endoplasmic reticulum0.126

Rank 5 · TkA08G072300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11437Vanabin-268-84 aa

PF00068Phospholip_A2_188-142 aa

PF06951PLA2G12107-144 aa

PF11437Vanabin-2112-163 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G072300	`PF11437`	Vanabin-2	68	84	0.47	11.4
TkA08G072300	`PF00068`	Phospholip_A2_1	88	142	0.00021	22.5
TkA08G072300	`PF06951`	PLA2G12	107	144	0.02	15.6
TkA08G072300	`PF11437`	Vanabin-2	112	163	0.47	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZB4`	Arabidopsis thaliana	sp\|Q8GZB4\|PLA2B_ARATH Phospholipase A2-beta	56.600%	Swiss-Prot	Medium
`Q9M0D7`	Arabidopsis thaliana	sp\|Q9M0D7\|PLA2C_ARATH Phospholipase A2-gamma	59.500%	Swiss-Prot	Medium
`Q8GV50`	Arabidopsis thaliana	sp\|Q8GV50\|PLA2D_ARATH Phospholipase A2-delta	55.700%	Swiss-Prot	Medium
`Q9XG80`	Oryza sativa subsp. japonica	sp\|Q9XG80\|PLA21_ORYSJ Probable phospholipase A2 homolog 1	68.200%	Swiss-Prot	Medium
`Q10E50`	Oryza sativa subsp. japonica	sp\|Q10E50\|PLA23_ORYSJ Phospholipase A2 homolog 3	34.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card