TkA08G054130 | RubberDandelionOmics

Gene overview

TkA08G054130

Reference: TK1151 Chr: Chr08 Coordinates: 13872699-13877706 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2846 bp · TkA08G054130|TK1151|cDNA

CTTTCCCAAAAACATAACTCCACCAATACAAAGAATGCAAGAATAACTTATCTTTTATCTTTTACACACTAAAACACACAAGACAACAAAAAAATGGATCATGATCCATCAAACAACGGTCCATAATGATTGATCCATACGGATTGCCTGCAATCCGAAGTGGTGATGTTTCAAGAGAATCGTCCGGTCGACACTCATCGGTTCATGAAATGGTGGTTCAAATGGATGACACGAGGTTATCAGTCCCGGGTATGCTAAGT...

CDS

Download CDS FASTA

813 bp · TkA08G054130|TK1151|CDS

ATGTACCTTTTTATACAGTGTCCAAGAATATCACATTTCGAATGGCATCCATTCAGCATCACTTCCGCACCTCTAGATGACTACCTAAGTGTACACATTCGTACTTTGGGAGATTGGACAAAAGCACTTAGAGAAGAATTCGCAAAGGCCTGTGAGGCTCAGCTGATGAGTAAAAATCTAGAAGGAACTCTTGCCAAAATTGAAACGCATGCTAAAGAATCACAAACAAAGTATCCTAAGATCTACATCAAAGGGCCATA...

Protein

Download Protein FASTA

270 aa · TkA08G054130|TK1151|PROTEIN

MYLFIQCPRISHFEWHPFSITSAPLDDYLSVHIRTLGDWTKALREEFAKACEAQLMSKNLEGTLAKIETHAKESQTKYPKIYIKGPYGAPSQHYMDYQVLLLIGLGIGATPFISILNDLLHNLKQSRLGDFNLNKRAYFFWVTREQGSFEWFKGVMDDIADHDHNNIIEMHNYLTSVYEQGDVRSALISMVQSLQHAKDGVDVVSQSKIKTHFARPNWRKVFNTLATTHEGSKIGVFYCGARALTKQLRELCKEFSLTNT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G054130`
TK1151 ID	TkA08G054130
OH-1004 ID	LXL04_017718
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.100
Protein coverage (%)	TK1151 100.000 / OH-1004 33.373 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G054130

Location Chr08:13872699-13877706 (+)

Description Similar to RBOHH: Putative respiratory burst oxidase homolog protein H

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60010`	Calcium-dependent NADPH oxidase that generates superoxide.	No verified direct reference in this release
`At3g45810`	Calcium-dependent NADPH oxidase that generates superoxide.	No verified direct reference in this release
`At1g64060`	Calcium-dependent NADPH oxidase that generates superoxide.	Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response.2002 · DOI: 10.1073/pnas.012452499 NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.2003 · DOI: 10.1093/emboj/cdg277 Extracellular ATP induces the accumulation of superoxide via NADPH oxidases in Arabidopsis.2006 · DOI: 10.1104/pp.105.073072 Ethylene-induced stomatal closure in Arabidopsis occurs via AtrbohF-mediated hydrogen peroxide synthesis.2006 · DOI: 10.1111/j.1365-313x.2006.02842.x
`At5g47910`	Calcium-dependent NADPH oxidase that generates superoxide.	Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response.2002 · DOI: 10.1073/pnas.012452499 NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.2003 · DOI: 10.1093/emboj/cdg277 Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis.2005 · DOI: 10.1105/tpc.104.026971 Extracellular ATP induces the accumulation of superoxide via NADPH oxidases in Arabidopsis.2006 · DOI: 10.1104/pp.105.073072 The role of NADPH oxidase and MAP kinase phosphatase in UV-B-dependent gene expression in Arabidopsis.2006 · DOI: 10.1111/j.1365-3040.2006.01555.x Arabidopsis thaliana expresses multiple lines of defense to counterattack Erwinia chrysanthemi.2007 · DOI: 10.1094/mpmi-20-7-0794 The MAP4 Kinase SIK1 Ensures Robust Extracellular ROS Burst and Antibacterial Immunity in Plants.2018 · DOI: 10.1016/j.chom.2018.08.007

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017718 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002679 respiratory burst involved in defense response Biological Process

GO:0006952 defense response Biological Process

GO:0007231 osmosensory signaling pathway Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0033500 carbohydrate homeostasis Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0050665 hydrogen peroxide biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G64060

ath:AT3G45810

ath:AT5G60010

sot:102579392

sot:102603596

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.444

Rank 1 · TkA08G054130 · TK1151

Cytoplasm0.300

Rank 2 · TkA08G054130 · TK1151

Endoplasmic reticulum0.190

Rank 3 · TkA08G054130 · TK1151

Golgi apparatus0.108

Rank 4 · TkA08G054130 · TK1151

Nucleus0.105

Rank 5 · TkA08G054130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08022FAD_binding_82-91 aa

PF10290YJL171C_Tos1_N16-34 aa

PF10290YJL171C_Tos1_N50-65 aa

PF19980DUF641652-95 aa

PF08030NAD_binding_697-252 aa

PF15565Imm30144-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G054130	`PF08022`	FAD_binding_8	2	91	7.9e-22	78.1
TkA08G054130	`PF10290`	YJL171C_Tos1_N	16	34	0.11	13.6
TkA08G054130	`PF10290`	YJL171C_Tos1_N	50	65	0.11	13.6
TkA08G054130	`PF19980`	DUF6416	52	95	0.23	12.7
TkA08G054130	`PF08030`	NAD_binding_6	97	252	1.7e-46	158.8
TkA08G054130	`PF15565`	Imm30	144	224	0.15	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJD6`	Arabidopsis thaliana	sp\|Q9FJD6\|RBOHH_ARATH Putative respiratory burst oxidase homolog protein H	59.800%	Swiss-Prot	High
`Q9LZU9`	Arabidopsis thaliana	sp\|Q9LZU9\|RBOHJ_ARATH Putative respiratory burst oxidase homolog protein J	57.100%	Swiss-Prot	High
`O48538`	Arabidopsis thaliana	sp\|O48538\|RBOHF_ARATH Respiratory burst oxidase homolog protein F	53.700%	Swiss-Prot	High
`Q9FIJ0`	Arabidopsis thaliana	sp\|Q9FIJ0\|RBOHD_ARATH Respiratory burst oxidase homolog protein D	54.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card