TkA08G039940 | RubberDandelionOmics

Gene overview

TkA08G039940

Reference: TK1151 Chr: Chr08 Coordinates: 10138038-10146768 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2214 bp · TkA08G039940|TK1151|cDNA

ATGAAGCATATTACCGGTAGTCGTGATGCTATTTCCGAAGGCTTACAAGCCAGAGGTTATAAAGCATTAGGCAGAGGAAAATATCCTCAACCTTCCAGTGAGGCCAATTCCAAGTTAGAAGACAGGCGTAAGTTCTGCAATTATTGTCAAAAGAAGGGACATGAAATTGAAGATTGTTTCAAGTTACGGAACAACATATCAGAAAAGGACAAGTTAGATGGTCACAATCAGGCTAGCGCATCTGGTGAGTCAGATGTTGC...

CDS

Download CDS FASTA

2214 bp · TkA08G039940|TK1151|CDS

ATGAAGCATATTACCGGTAGTCGTGATGCTATTTCCGAAGGCTTACAAGCCAGAGGTTATAAAGCATTAGGCAGAGGAAAATATCCTCAACCTTCCAGTGAGGCCAATTCCAAGTTAGAAGACAGGCGTAAGTTCTGCAATTATTGTCAAAAGAAGGGACATGAAATTGAAGATTGTTTCAAGTTACGGAACAACATATCAGAAAAGGACAAGTTAGATGGTCACAATCAGGCTAGCGCATCTGGTGAGTCAGATGTTGC...

Protein

Download Protein FASTA

737 aa · TkA08G039940|TK1151|PROTEIN

MKHITGSRDAISEGLQARGYKALGRGKYPQPSSEANSKLEDRRKFCNYCQKKGHEIEDCFKLRNNISEKDKLDGHNQASASGESDVAEPGLLKKFEVSIIVRMNNGEVRRLVHSGRRGSAKLKRVMQTILSLGNALNQGTARGCAIGFRLDSLLKLTETRARNNGMTLMHYLCKVLADKLPEVLDFSKDLSSKRGHSDDSSAFNMNTLDEIQRITVKDLAELGLIKLQQVCEARNLDRGVVESGLTFAGDSAAVLAELKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G039940`
TK1151 ID	TkA08G039940
OH-1004 ID	LXL04_029434
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	71.100
Protein coverage (%)	TK1151 40.027 / OH-1004 79.582 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G039940

Location Chr08:10138038-10146768 (+)

Description Similar to FH18: Formin-like protein 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50000`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates (By similarity).	No verified direct reference in this release
`At5g67380`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	Cloning and characterization of two cDNAs encoding casein kinase II catalytic subunits in Arabidopsis thaliana.1993 · DOI: 10.1007/bf00019944 Reconstitution of Arabidopsis casein kinase II from recombinant subunits and phosphorylation of transcription factor GBF1.1995 · DOI: 10.1105/tpc.7.1.105

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0794900`	Formin-like protein 7.	No verified direct reference in this release
`UniProt: Q9AR27`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	No verified direct reference in this release
`UniProt: B6F107`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029434 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0003779 actin binding Molecular Function

GO:0004721 phosphoprotein phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT2G25050

ath:AT3G32400

ath:AT5G58160

dosa:Os02g0794900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.537

Rank 1 · TkA08G039940 · TK1151

Nucleus0.357

Rank 2 · TkA08G039940 · TK1151

Cell membrane0.105

Rank 3 · TkA08G039940 · TK1151

Mitochondrion0.064

Rank 4 · TkA08G039940 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA08G039940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16641CLIP1_ZNF43-59 aa

PF13696zf-CCHC_246-59 aa

PF02181FH2118-208 aa

PF16641CLIP1_ZNF296-299 aa

PF24132DUF7399388-418 aa

PF24132DUF7399528-566 aa

PF29635RXLR-C08676-732 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G039940	`PF16641`	CLIP1_ZNF	43	59	1.6	9.4
TkA08G039940	`PF13696`	zf-CCHC_2	46	59	1.2	9.7
TkA08G039940	`PF02181`	FH2	118	208	6.2e-27	95.4
TkA08G039940	`PF16641`	CLIP1_ZNF	296	299	1.6	9.4
TkA08G039940	`PF24132`	DUF7399	388	418	0.029	15.5
TkA08G039940	`PF24132`	DUF7399	528	566	0.029	15.5
TkA08G039940	`PF29635`	RXLR-C08	676	732	0.047	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q08466`	Arabidopsis thaliana	sp\|Q08466\|CSK22_ARATH Casein kinase II subunit alpha-2	66.700%	Swiss-Prot	Low
`Q08467`	Arabidopsis thaliana	sp\|Q08467\|CSK21_ARATH Casein kinase II subunit alpha-1	67.700%	Swiss-Prot	Low
`Q6K8Z4`	Oryza sativa subsp. japonica	sp\|Q6K8Z4\|FH7_ORYSJ Formin-like protein 7	64.900%	Swiss-Prot	Low
`Q9AR27`	Oryza sativa subsp. indica	sp\|Q9AR27\|HD6_ORYSI Casein kinase II subunit alpha-2	63.600%	Swiss-Prot	Low
`B6F107`	Oryza sativa subsp. japonica	sp\|B6F107\|HD6_ORYSJ Casein kinase II subunit alpha-2	63.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card