TkA08G028850 | RubberDandelionOmics

Gene overview

TkA08G028850

Reference: TK1151 Chr: Chr08 Coordinates: 7409691-7411502 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1066 bp · TkA08G028850|TK1151|cDNA

ATGGCGGTTCTAACATTGCCACACTGTTTTCCATTACAATCGGTCAACGGCCGACGTAATAGTCATCGAAAACGGTGTAATAATAGCGGCGGTCAAGAGCTGTGCTCGGAAGTTGAGAGAATAAGGATCGATAAATCTGCTTTGAAGATAGAGGAAGCATGCTCAGATGCGGAGCTTTGGGCCACGTCTCGTCTTCGAGTGAGATCTTTCTATGATTTCAAGTCAACTTTTGGAATCGAAGATCATAAAAAATACTTAGC...

CDS

Download CDS FASTA

771 bp · TkA08G028850|TK1151|CDS

ATGGCGGTTCTAACATTGCCACACTGTTTTCCATTACAATCGGTCAACGGCCGACGTAATAGTCATCGAAAACGGTGTAATAATAGCGGCGGTCAAGAGCTGTGCTCGGAAGTTGAGAGAATAAGGATCGATAAATCTGCTTTGAAGATAGAGGAAGCATGCTCAGATGCGGAGCTTTGGGCCACGTCTCGTCTTCGAGTGAGATCTTTCTATGATTTCAAGTCAACTTTTGGAATCGAAGATCATAAAAAATACTTAGC...

Protein

Download Protein FASTA

256 aa · TkA08G028850|TK1151|PROTEIN

MAVLTLPHCFPLQSVNGRRNSHRKRCNNSGGQELCSEVERIRIDKSALKIEEACSDAELWATSRLRVRSFYDFKSTFGIEDHKKYLAEREFEALKDRLSGTKEGEKVSCINATLLSSQTSFPEELCSSCKFSDNGEDRIVIGSLDVNQCMSLPNEITGMKPKEIGGGFARAYLSNVCVAKECQRNGIAFLLVEKSKLVAKNLGISDLYVHVAVDNEAAKNLYMKCGFVYESEEPAWQARFLDRPRRLLLWMGLPNC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G028850`
TK1151 ID	TkA08G028850
OH-1004 ID	LXL04_018078
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G028850

Location Chr08:7409691-7411502 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g28030`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a large spectrum of modified N-termini, including methionine, alanine, serine, threonine and to a lower extent valine and proline as substrates, and epsilon-lysine acetylation (KA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018078 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0004596 protein-N-terminal amino-acid acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G06025

ath:AT4G28030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.968

Rank 1 · TkA08G028850 · TK1151

Nucleus0.036

Rank 2 · TkA08G028850 · TK1151

Mitochondrion0.035

Rank 3 · TkA08G028850 · TK1151

Cytoplasm0.029

Rank 4 · TkA08G028850 · TK1151

Peroxisome0.017

Rank 5 · TkA08G028850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00583Acetyltransf_1167-227 aa

PF13508Acetyltransf_7170-228 aa

PF13673Acetyltransf_10170-232 aa

PF08445FR47172-229 aa

PF13302Acetyltransf_3177-228 aa

PF13420Acetyltransf_4180-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G028850	`PF00583`	Acetyltransf_1	167	227	7.4e-11	43.1
TkA08G028850	`PF13508`	Acetyltransf_7	170	228	1.5e-07	32.4
TkA08G028850	`PF13673`	Acetyltransf_10	170	232	3.5e-06	27.8
TkA08G028850	`PF08445`	FR47	172	229	1.5e-05	25.6
TkA08G028850	`PF13302`	Acetyltransf_3	177	228	0.032	15.7
TkA08G028850	`PF13420`	Acetyltransf_4	180	229	0.083	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AC8`	Arabidopsis thaliana	sp\|Q94AC8\|GNAT7_ARATH GCN5-related N-acetyltransferase 7, chloroplastic	63.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card