TkA07G421070 | RubberDandelionOmics

Gene overview

TkA07G421070

Reference: TK1151 Chr: Chr07 Coordinates: 106409036-106411621 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · TkA07G421070|TK1151|cDNA

ATGCAAACAATTCTTTCTTTGGGAAATGCATTGAATCAGGGGACTGCAAGGGGGTGTGCGATTGGGTTCAGGTTGGATAGTCTGTTGAAACTTACAGAGACACGTGCAAGGAACAATGGAATGACACTCATGCATTATCTTTGTAAGGTACTTGCTGACAAACTACCTGAGGTTCTTGACTTTTCCAAGGATCTTAGCAGTAAAAGAGGGCATAGTGACGATTCATCTGTAAAATCTCTCTTATTCCATATTACCTTTTT...

CDS

Download CDS FASTA

918 bp · TkA07G421070|TK1151|CDS

ATGCAAACAATTCTTTCTTTGGGAAATGCATTGAATCAGGGGACTGCAAGGGGGTGTGCGATTGGGTTCAGGTTGGATAGTCTGTTGAAACTTACAGAGACACGTGCAAGGAACAATGGAATGACACTCATGCATTATCTTTGTAAGGTACTTGCTGACAAACTACCTGAGGTTCTTGACTTTTCCAAGGATCTTAGCAGTAAAAGAGGGCATAGTGACGATTCATCTGTAAAATCTCTCTTATTCCATATTACCTTTTT...

Protein

Download Protein FASTA

305 aa · TkA07G421070|TK1151|PROTEIN

MQTILSLGNALNQGTARGCAIGFRLDSLLKLTETRARNNGMTLMHYLCKVLADKLPEVLDFSKDLSSKRGHSDDSSVKSLLFHITFFENLAFNMNALDEIQRITVKDLAELGLIKLQQGRKDLVICVVEKVPSVPENVTDQFTVCTGHFVAIFTIVNGAVNAYVIDFCWCLMQIFRKEPFFYGHDNQDQLVKIARVLGTDELNAYLNKHSRKPWSKFMNAYNQHLVSPEAIDFLDRLTAKEAMGHPYFCVFCTTYLIMMV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G421070`
TK1151 ID	TkA07G421070
OH-1004 ID	LXL04_029434
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	73.000
Protein coverage (%)	TK1151 98.689 / OH-1004 78.422 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G421070

Location Chr07:106409036-106411621 (-)

Description Similar to FH18: Formin-like protein 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50000`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates (By similarity).	No verified direct reference in this release
`At5g67380`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	Cloning and characterization of two cDNAs encoding casein kinase II catalytic subunits in Arabidopsis thaliana.1993 · DOI: 10.1007/bf00019944 Reconstitution of Arabidopsis casein kinase II from recombinant subunits and phosphorylation of transcription factor GBF1.1995 · DOI: 10.1105/tpc.7.1.105

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9AR27`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	No verified direct reference in this release
`UniProt: B6F107`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029434 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0003779 actin binding Molecular Function

GO:0004721 phosphoprotein phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT2G25050

ath:AT3G32400

ath:AT5G58160

dosa:Os02g0794900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.408

Rank 1 · TkA07G421070 · TK1151

Nucleus0.273

Rank 2 · TkA07G421070 · TK1151

Cell membrane0.148

Rank 3 · TkA07G421070 · TK1151

Endoplasmic reticulum0.129

Rank 4 · TkA07G421070 · TK1151

Mitochondrion0.123

Rank 5 · TkA07G421070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02181FH21-67 aa

PF03849Tfb271-121 aa

PF25361AAA_lid_RFC176-107 aa

PF00515TPR_1110-122 aa

PF25361AAA_lid_RFC1125-147 aa

PF04343DUF488194-250 aa

PF22751DUF488-N3a203-252 aa

PF27660SCI1_hairpin208-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G421070	`PF02181`	FH2	1	67	6.4e-24	85.5
TkA07G421070	`PF03849`	Tfb2	71	121	0.029	14.0
TkA07G421070	`PF25361`	AAA_lid_RFC1	76	107	0.1	12.8
TkA07G421070	`PF00515`	TPR_1	110	122	0.045	14.3
TkA07G421070	`PF25361`	AAA_lid_RFC1	125	147	0.1	12.8
TkA07G421070	`PF04343`	DUF488	194	250	0.075	14.4
TkA07G421070	`PF22751`	DUF488-N3a	203	252	0.16	13.0
TkA07G421070	`PF27660`	SCI1_hairpin	208	224	0.25	11.7
TkA07G421070	`PF27660`	SCI1_hairpin	233	244	0.25	11.7
TkA07G421070	`PF00515`	TPR_1	266	282	0.045	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q08466`	Arabidopsis thaliana	sp\|Q08466\|CSK22_ARATH Casein kinase II subunit alpha-2	66.700%	Swiss-Prot	Low
`Q08467`	Arabidopsis thaliana	sp\|Q08467\|CSK21_ARATH Casein kinase II subunit alpha-1	67.600%	Swiss-Prot	Low
`Q9AR27`	Oryza sativa subsp. indica	sp\|Q9AR27\|HD6_ORYSI Casein kinase II subunit alpha-2	63.800%	Swiss-Prot	Low
`B6F107`	Oryza sativa subsp. japonica	sp\|B6F107\|HD6_ORYSJ Casein kinase II subunit alpha-2	63.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card