TkA07G397700 | RubberDandelionOmics

Gene overview

TkA07G397700

Reference: TK1151 Chr: Chr07 Coordinates: 99935251-99937616 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1422 bp · TkA07G397700|TK1151|cDNA

AAAAGTAGCCCAGAGCCTATTTTATTAGTTTGAGCTTTTAGCTTCACAATTCGCAAAACCCCCGTCGGTCCGCCCTCATCTTTGTCTGATTTAGGGTTACAGTCGAGCTCCGTTCAATCGATTTTGCAAGAAACGTAAGCAAAGATGAGGCCGATATTGATGAAAGGGCACGAGAGGCCACTCACGTTTCTCAAGTATAACAGGGATGGTGACCTTCTCTTCTCTTGCGCCAAAGATCACACTCCTACTGTCTGGTTCGC...

CDS

Download CDS FASTA

984 bp · TkA07G397700|TK1151|CDS

ATGAGGCCGATATTGATGAAAGGGCACGAGAGGCCACTCACGTTTCTCAAGTATAACAGGGATGGTGACCTTCTCTTCTCTTGCGCCAAAGATCACACTCCTACTGTCTGGTTCGCTGACAACGGCGAGCGACTGGGCACATATCGTGGCCACAATGGTGCCGTATGGTGCTGCGACGTTTCAAGAGATTCAACACGATTGATTACCGGGAGTGCCGATCAGTCAGCCAAGCTATGGGATGTTCAGAGCGGAGCACAGCT...

Protein

Download Protein FASTA

327 aa · TkA07G397700|TK1151|PROTEIN

MRPILMKGHERPLTFLKYNRDGDLLFSCAKDHTPTVWFADNGERLGTYRGHNGAVWCCDVSRDSTRLITGSADQSAKLWDVQSGAQLFTFSFDSPARAVDFSVGDKLAVITTDPFMGLTSAIHVKRIASDPDDQVGESVLVLKGPQGRINRAVWGPLNKTIISAGEDAVVRIWDTETGKLLQENDKEIGHKKTITSLAKSTDCSHFLTGSLDKSAKLWDIRSLTLIKTYVTERPVNAVAMSPLLNHVVLGGGQDASAVTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G397700`
TK1151 ID	TkA07G397700
OH-1004 ID	LXL04_030332
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G397700

Location Chr07:99935251-99937616 (+)

Description Similar to TIF3I1: Eukaryotic translation initiation factor 3 subunit I

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46280`	Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030332 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001732 formation of cytoplasmic translation initiation complex Biological Process

GO:0002183 cytoplasmic translational initiation Biological Process

GO:0006413 translational initiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005852 eukaryotic translation initiation factor 3 complex Cellular Component

GO:0016282 eukaryotic 43S preinitiation complex Cellular Component

GO:0033290 eukaryotic 48S preinitiation complex Cellular Component

GO:0071541 eukaryotic translation initiation factor 3 complex, eIF3m Cellular Component

GO:0080008 Cul4-RING E3 ubiquitin ligase complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003743 translation initiation factor activity Molecular Function

KEGG gene cross-reference

aag:5577291

ath:AT2G46280

cqu:CpipJ_CPIJ018275

cqu:CpipJ_CPIJ018457

xtr:548498

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.530

Rank 1 · TkA07G397700 · TK1151

Nucleus0.418

Rank 2 · TkA07G397700 · TK1151

Cell membrane0.103

Rank 3 · TkA07G397700 · TK1151

Lysosome / Vacuole0.084

Rank 4 · TkA07G397700 · TK1151

Golgi apparatus0.047

Rank 5 · TkA07G397700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24805EIF3I1-323 aa

PF25173Beta-prop_WDR3_1st5-90 aa

PF23775Beta-prop_RIG_2nd5-58 aa

PF25460Beta-prop_Aladin5-82 aa

PF00400WD406-37 aa

PF25175Beta-prop_WDR56-107 aa

PF24814WD40_Prp196-91 aa

PF24807WD40_CDC20-Fz6-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G397700	`PF24805`	EIF3I	1	323	5.5e-128	427.4
TkA07G397700	`PF25173`	Beta-prop_WDR3_1st	5	90	5.2e-35	121.5
TkA07G397700	`PF23775`	Beta-prop_RIG_2nd	5	58	2.9e-11	44.0
TkA07G397700	`PF25460`	Beta-prop_Aladin	5	82	1.5e-08	34.9
TkA07G397700	`PF00400`	WD40	6	37	7.4e-43	143.9
TkA07G397700	`PF25175`	Beta-prop_WDR5	6	107	6e-38	131.5
TkA07G397700	`PF24814`	WD40_Prp19	6	91	1.6e-26	93.7
TkA07G397700	`PF24807`	WD40_CDC20-Fz	6	173	8.4e-24	85.1
TkA07G397700	`PF25047`	Beta-prop_TEP1_2nd	6	37	5.9e-18	65.7
TkA07G397700	`PF24780`	WD40_MABP1-WDR62_1st	6	103	1e-07	32.3
TkA07G397700	`PF23342`	WDR90_beta-prop_4th	6	63	4e-06	26.9
TkA07G397700	`PF23798`	Beta-prop_SPT8	6	56	1.7e-05	24.6
TkA07G397700	`PF23609`	Beta-prop_EIPR1	6	37	0.00079	19.7
TkA07G397700	`PF25172`	Beta-prop_WDR3_2nd	7	80	8.4e-22	78.4
TkA07G397700	`PF24796`	WDR55	7	90	1e-14	55.0
TkA07G397700	`PF23393`	Beta-prop_WDR90_POC16_2nd	7	31	1.1e-11	45.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38884`	Arabidopsis thaliana	sp\|Q38884\|EIF3I_ARATH Eukaryotic translation initiation factor 3 subunit I	74.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card