TkA07G259280 | RubberDandelionOmics

Gene overview

TkA07G259280

Reference: TK1151 Chr: Chr07 Coordinates: 64823790-64825157 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1287 bp · TkA07G259280|TK1151|cDNA

ATGCTGGATCGGATTTTGGGGACTCGCCGGACGCGTCAGTTCCAGCGGATTATCCGTAACGGCAAGATCACGCTTTTCTGCTTGGTCCTAACCATCGTCGTCCTGCGTGGCAACCTCGGTGCCGGCAACGTCCTCGAAGAATTGCAGACCACAACTGAGCAGACGGCATCGTCAACGACCAATAATTACGCGGAATTCGACATCAACAAGTTGTTTGTCGATGAAGAAGACGATGTGAAGAAGAATCCAAACGAGCCCTA...

CDS

Download CDS FASTA

1287 bp · TkA07G259280|TK1151|CDS

ATGCTGGATCGGATTTTGGGGACTCGCCGGACGCGTCAGTTCCAGCGGATTATCCGTAACGGCAAGATCACGCTTTTCTGCTTGGTCCTAACCATCGTCGTCCTGCGTGGCAACCTCGGTGCCGGCAACGTCCTCGAAGAATTGCAGACCACAACTGAGCAGACGGCATCGTCAACGACCAATAATTACGCGGAATTCGACATCAACAAGTTGTTTGTCGATGAAGAAGACGATGTGAAGAAGAATCCAAACGAGCCCTA...

Protein

Download Protein FASTA

428 aa · TkA07G259280|TK1151|PROTEIN

MLDRILGTRRTRQFQRIIRNGKITLFCLVLTIVVLRGNLGAGNVLEELQTTTEQTASSTTNNYAEFDINKLFVDEEDDVKKNPNEPYSIGPKISDWDEQRGEWLKQNPTFPNFLNANKPRVLLVTGSSPKPCENPVGDHYLLKSIKNKIDYCRVHGIEIFYNMALLDAEMAGFWAKLPLIRKLLLSHPEVEFLWWMDSDAMFTDMAFEVPWERYKDKNLVLHGWNEMVYDQKNWIGLNTGSFLLRNCQWSLDLIDAWAPM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G259280`
TK1151 ID	TkA07G259280
OH-1004 ID	LXL04_028989
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.800
Protein coverage (%)	TK1151 99.299 / OH-1004 90.763 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G259280

Location Chr07:64823790-64825157 (+)

Description Similar to XXT1: Xyloglucan 6-xylosyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02500`	Xylosyltransferase specific to UDP-D-xylose that accepts both cellopentaose and cellohexaose as substrates, with a better use of cellohexaose, to produce xyloglucan.	Disrupting two Arabidopsis thaliana xylosyltransferase genes results in plants deficient in xyloglucan, a major primary cell wall component.2008 · DOI: 10.1105/tpc.108.059873 Protein-protein interactions among xyloglucan-synthesizing enzymes and formation of Golgi-localized multiprotein complexes.2015 · DOI: 10.1093/pcp/pcu161
`At3g62720`	Xylosyltransferase specific to UDP-D-xylose that accepts both cellopentaose and cellohexaose as substrates, with a better use of cellohexaose, to produce xyloglucan.	Disrupting two Arabidopsis thaliana xylosyltransferase genes results in plants deficient in xyloglucan, a major primary cell wall component.2008 · DOI: 10.1105/tpc.108.059873 Structure of xyloglucan xylosyltransferase 1 reveals simple steric rules that define biological patterns of xyloglucan polymers.2018 · DOI: 10.1073/pnas.1801105115
`At1g74380`	Probable xyloglucan xylosyltransferase involved in the biosynthesis of xyloglucan in roots.	Arabidopsis XXT5 gene encodes a putative alpha-1,6-xylosyltransferase that is involved in xyloglucan biosynthesis.2008 · DOI: 10.1111/j.1365-313x.2008.03580.x Protein-protein interactions among xyloglucan-synthesizing enzymes and formation of Golgi-localized multiprotein complexes.2015 · DOI: 10.1093/pcp/pcu161

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XFP3`	Probable xyloglucan xylosyltransferase involved in the biosynthesis of xyloglucan in roots.	No verified direct reference in this release
`Os03g0300000`	Probable xyloglucan xylosyltransferase involved in the biosynthesis of xyloglucan in roots.	Mutation in xyloglucan 6-xylosytransferase results in abnormal root hair development in Oryza sativa.2014 · DOI: 10.1093/jxb/eru189

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028989 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000271 polysaccharide biosynthetic process Biological Process

GO:0009969 xyloglucan biosynthetic process Biological Process

GO:0010411 xyloglucan metabolic process Biological Process

GO:0048767 root hair elongation Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016758 hexosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G74380

ath:AT3G62720

ath:AT4G02500

dosa:Os03g0300000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.779

Rank 1 · TkA07G259280 · TK1151

Endoplasmic reticulum0.168

Rank 2 · TkA07G259280 · TK1151

Cytoplasm0.086

Rank 3 · TkA07G259280 · TK1151

Cell membrane0.045

Rank 4 · TkA07G259280 · TK1151

Extracellular0.044

Rank 5 · TkA07G259280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05637Glyco_transf_34118-357 aa

PF03314DUF273203-258 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G259280	`PF05637`	Glyco_transf_34	118	357	1.7e-65	221.9
TkA07G259280	`PF03314`	DUF273	203	258	0.23	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22775`	Arabidopsis thaliana	sp\|O22775\|XXT2_ARATH Xyloglucan 6-xylosyltransferase 2	74.300%	Swiss-Prot	High
`Q9LZJ3`	Arabidopsis thaliana	sp\|Q9LZJ3\|XXT1_ARATH Xyloglucan 6-xylosyltransferase 1	73.400%	Swiss-Prot	High
`Q9CA75`	Arabidopsis thaliana	sp\|Q9CA75\|XXT5_ARATH Probable xyloglucan 6-xylosyltransferase 5	62.300%	Swiss-Prot	High
`A2XFP3`	Oryza sativa subsp. indica	sp\|A2XFP3\|XXT1_ORYSI Probable xyloglucan 6-xylosyltransferase 1	68.900%	Swiss-Prot	High
`Q10MQ0`	Oryza sativa subsp. japonica	sp\|Q10MQ0\|XXT1_ORYSJ Probable xyloglucan 6-xylosyltransferase 1	68.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card