TkA07G176520 | RubberDandelionOmics

Gene overview

TkA07G176520

Reference: TK1151 Chr: Chr07 Coordinates: 45139199-45141386 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1882 bp · TkA07G176520|TK1151|cDNA

TGGCAATGGTAGCCTGAAAATATATTTCCAAATACAAAAATACTGTGTTTGTAGAGGGGAAGGGTCGATGTTTCCAGATTGGGGTTTTTTTTGAACGTGAAACCGCTCTTTCAAGAGATTTTGCCCTCCCTTCCTCTACGGTATTGGTCGTCTCATGATCTGACCTCCGTTATCTCTCGAAATCGAAACCCCGAAGCAAACCCTTCTAAACTTTTCATCAAATCCCATTTGAAACCCAGTCTCCAAATTCTCAATGTCTT...

CDS

Download CDS FASTA

1338 bp · TkA07G176520|TK1151|CDS

ATGTCTTCGTCCACTGTCTCAATCACTGCGAACCCTTCTGGTGCTGTGCTGCGTAGACCTTTACTCACCGGTGAGAAAAAATCCGGCGTAGATTTGGGCGGCAGTGATGGAATTGAAGCATCTGCGCGAAGCGGCGGCGAAACTAGCAGAGGGAAAGATCTCAGCCATTCATTCAGAGCAGGAGCAGAAACCGTTCTCGAAAGATCTAGAGACGCTGTTCAAACGAAGAACCCCTTACCCACGAATTCAACCACCAAGAC...

Protein

Download Protein FASTA

445 aa · TkA07G176520|TK1151|PROTEIN

MSSSTVSITANPSGAVLRRPLLTGEKKSGVDLGGSDGIEASARSGGETSRGKDLSHSFRAGAETVLERSRDAVQTKNPLPTNSTTKTRKRTADKKVSVPSTTKAPWKRAVSVLMKNFALLVILLLLAQMIRKLAFNQGSGFDSILIPSSDYESQFAEVEARLKSTTQAMQFQVDVMNQKMVEEIVGLKTELTKRIADKGAELSSRVNDLDGKFQTMKKTLTTDWLSRDEFNRFVEDFKSKKGMDDVNKLNLDEVRAFAKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G176520`
TK1151 ID	TkA07G176520
OH-1004 ID	LXL04_028633
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.500
Protein coverage (%)	TK1151 97.978 / OH-1004 74.150 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G176520

Location Chr07:45139199-45141386 (-)

Description Similar to SUN1: SUN domain-containing protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04990`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments.	Dynamics of Arabidopsis SUN proteins during mitosis and their involvement in nuclear shaping.2011 · DOI: 10.1111/j.1365-313x.2011.04523.x Absence of SUN1 and SUN2 proteins in Arabidopsis thaliana leads to a delay in meiotic progression and defects in synapsis and recombination.2015 · DOI: 10.1111/tpj.12730 Plant nuclear shape is independently determined by the SUN-WIP-WIT2-myosin XI-i complex and CRWN1.2015 · DOI: 10.1080/19491034.2014.1003512
`At3g10730`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments.	Dynamics of Arabidopsis SUN proteins during mitosis and their involvement in nuclear shaping.2011 · DOI: 10.1111/j.1365-313x.2011.04523.x Absence of SUN1 and SUN2 proteins in Arabidopsis thaliana leads to a delay in meiotic progression and defects in synapsis and recombination.2015 · DOI: 10.1111/tpj.12730 Plant nuclear shape is independently determined by the SUN-WIP-WIT2-myosin XI-i complex and CRWN1.2015 · DOI: 10.1080/19491034.2014.1003512

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028633 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006997 nucleus organization Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0051291 protein heterooligomerization Biological Process

GO:0070197 meiotic attachment of telomere to nuclear envelope Biological Process

GO:0090435 protein localization to nuclear envelope Biological Process

GO:2000769 regulation of establishment or maintenance of cell polarity regulating cell shape Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005819 spindle Cellular Component

KEGG gene cross-reference

ath:AT3G10730

ath:AT5G04990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.541

Rank 1 · TkA07G176520 · TK1151

Nucleus0.292

Rank 2 · TkA07G176520 · TK1151

Cytoplasm0.135

Rank 3 · TkA07G176520 · TK1151

Golgi apparatus0.131

Rank 4 · TkA07G176520 · TK1151

Cell membrane0.077

Rank 5 · TkA07G176520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03938OmpH150-244 aa

PF02961SAM_BAF167-225 aa

PF19788DUF6272241-287 aa

PF07738Sad1_UNC311-440 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G176520	`PF03938`	OmpH	150	244	0.15	13.0
TkA07G176520	`PF02961`	SAM_BAF	167	225	0.027	15.7
TkA07G176520	`PF19788`	DUF6272	241	287	0.037	14.4
TkA07G176520	`PF07738`	Sad1_UNC	311	440	1.2e-38	132.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FF75`	Arabidopsis thaliana	sp\|Q9FF75\|SUN1_ARATH SUN domain-containing protein 1	43.300%	Swiss-Prot	Medium
`Q9SG79`	Arabidopsis thaliana	sp\|Q9SG79\|SUN2_ARATH SUN domain-containing protein 2	42.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card