TkA07G120860 | RubberDandelionOmics

Gene overview

TkA07G120860

Reference: TK1151 Chr: Chr07 Coordinates: 31355624-31357554 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1086 bp · TkA07G120860|TK1151|cDNA

AAAGAAGCCTTTGGGATTGCAAAAAGGAAACCGATGAGATTAACACCAAGAAGTATATATTTCGCACACTTTTTCCCACGAGGTTCGGTTACACTTGCCCTAAAATTTCCAACGTCCCAAAAACCCTAATCTCTCTAATTATCCCCTAGCCGTTAAATTTCAAACGATACATCTAAACTTGTATATCTATATAACCGTATGGGAAAGAGAAAACGAAGAGCTGACCGGAACAAGACCCCTCCTTCTCCAGCCTTTGTGTC...

CDS

Download CDS FASTA

627 bp · TkA07G120860|TK1151|CDS

ATGGGAAAGAGAAAACGAAGAGCTGACCGGAACAAGACCCCTCCTTCTCCAGCCTTTGTGTCTCACATCTCTCAAATGGAGTCATCATTAAAAGAGAAATCTTCTCACTCAGTTGGCTCTACCGGAGGAAAGTCCACGTCATCACCGCCTGGCCACCACCAACCAGCCGCCAATCACCGCCACCACAATGCCAACCGGGCATTGTTATCAAGGGTGCCACGTCACTACTACAGTCTCCAACATCCACAACATAAAAATGC...

Protein

Download Protein FASTA

208 aa · TkA07G120860|TK1151|PROTEIN

MGKRKRRADRNKTPPSPAFVSHISQMESSLKEKSSHSVGSTGGKSTSSPPGHHQPAANHRHHNANRALLSRVPRHYYSLQHPQHKNANNSGTSNSHGKNSQRDDKLSWKFGHRQESGVGYHGGKRDKGSRRVDRIRSNTLVISAITPNVINVDCGLCRQKMSDNSVVAVLVCGHFYHAECLETRTRHEDRRDPPCPLCMPFGVYNGVV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G120860`
TK1151 ID	TkA07G120860
OH-1004 ID	LXL04_028093
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G120860`
Location	Chr07:31355624-31357554 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028093` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.581

Rank 1 · TkA07G120860 · TK1151

Cytoplasm0.381

Rank 2 · TkA07G120860 · TK1151

Cell membrane0.148

Rank 3 · TkA07G120860 · TK1151

Endoplasmic reticulum0.044

Rank 4 · TkA07G120860 · TK1151

Lysosome / Vacuole0.031

Rank 5 · TkA07G120860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25998U-box_ZFPL121-32 aa

PF15459RRP1459-107 aa

PF12678zf-rbx1144-198 aa

PF15227zf-C3HC4_4149-159 aa

PF14446Prok-RING_1150-182 aa

PF17120zf-RING_16150-189 aa

PF13639zf-RING_2153-198 aa

PF17123zf-RING_11153-181 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G120860	`PF25998`	U-box_ZFPL1	21	32	1.4	10.1
TkA07G120860	`PF15459`	RRP14	59	107	0.088	14.2
TkA07G120860	`PF12678`	zf-rbx1	144	198	8.2e-06	26.7
TkA07G120860	`PF15227`	zf-C3HC4_4	149	159	0.32	11.9
TkA07G120860	`PF14446`	Prok-RING_1	150	182	0.0048	17.7
TkA07G120860	`PF17120`	zf-RING_16	150	189	0.019	15.3
TkA07G120860	`PF13639`	zf-RING_2	153	198	1.8e-08	35.2
TkA07G120860	`PF17123`	zf-RING_11	153	181	2.6e-05	24.6
TkA07G120860	`PF27108`	PHD_Pygo	153	181	0.11	13.4
TkA07G120860	`PF13920`	zf-C3HC4_3	153	198	0.55	10.8
TkA07G120860	`PF14634`	zf-RING_5	154	198	9.3e-06	26.2
TkA07G120860	`PF23412`	zf_RING_Vps8	154	184	1.9e-05	25.1
TkA07G120860	`PF23555`	zf-RING_Vps41	154	184	9.4e-05	22.7
TkA07G120860	`PF00097`	zf-C3HC4	154	198	0.00015	22.3
TkA07G120860	`PF13445`	zf-RING_UBOX	154	196	0.00034	21.3
TkA07G120860	`PF13923`	zf-C3HC4_2	154	198	0.0031	18.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card