TkA07G050720 | RubberDandelionOmics

Gene overview

TkA07G050720

Reference: TK1151 Chr: Chr07 Coordinates: 13487498-13489300 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1242 bp · TkA07G050720|TK1151|cDNA

CCTACAACCCCAACAACATCAAACATGACCTACTTCCACCAAAAGGTTTCAACCCTAGCCATGACCTTGCCCTTCCTCATACTCCTAGTAGCCATGGTCTCTCGAGCCACTTCACGCACCCTTACTGACCAAACCATGTTCGTCAGACACGACCAATGGATGGCTGACCATGGGCGTGTTTATACAGATGAAAAAGAAAAACAACAGCGGTTTCAGATATTTAGAAACAACGTTGCCTATATTGAATCACATAATAGTCG...

CDS

Download CDS FASTA

1038 bp · TkA07G050720|TK1151|CDS

ATGACCTACTTCCACCAAAAGGTTTCAACCCTAGCCATGACCTTGCCCTTCCTCATACTCCTAGTAGCCATGGTCTCTCGAGCCACTTCACGCACCCTTACTGACCAAACCATGTTCGTCAGACACGACCAATGGATGGCTGACCATGGGCGTGTTTATACAGATGAAAAAGAAAAACAACAGCGGTTTCAGATATTTAGAAACAACGTTGCCTATATTGAATCACATAATAGTCGTTCTGACCAAAGTTACACACTTGA...

Protein

Download Protein FASTA

345 aa · TkA07G050720|TK1151|PROTEIN

MTYFHQKVSTLAMTLPFLILLVAMVSRATSRTLTDQTMFVRHDQWMADHGRVYTDEKEKQQRFQIFRNNVAYIESHNSRSDQSYTLEVNKFADLTNEEFRASRNGYKKQLVSSAVSGLFRYANVSAVPNEVDWRKEGVVTPVKDQGQCGCCWAFSAVAAMEGINKLKNGKLVSLSEQELVDCDIDGIDQGCEGGLMENAFQFIEKQKGLAAESVYPYTGEDGVCNTKKAVIPAAKISGYEKVPANNEKALLQAVAHQPVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G050720`
TK1151 ID	TkA07G050720
OH-1004 ID	LXL04_027333
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	88.300
Protein coverage (%)	TK1151 98.841 / OH-1004 34.661 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G050720

Location Chr07:13487498-13489300 (-)

Description Similar to ATG7: Ubiquitin-like modifier-activating enzyme atg7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45890`	Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.	Identification of a promoter region responsible for the senescence-specific expression of SAG12.1999 · DOI: 10.1023/a:1006342412688 HDA6 is required for jasmonate response, senescence and flowering in Arabidopsis.2008 · DOI: 10.1093/jxb/erm300 Natural developmental variations in leaf and plant senescence in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1438-8677.2008.00108.x Epigenetic programming via histone methylation at WRKY53 controls leaf senescence in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1365-313x.2008.03782.x Nitric oxide is involved in cadmium-induced programmed cell death in Arabidopsis suspension cultures.2009 · DOI: 10.1104/pp.108.133397

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XQE8`	Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.	No verified direct reference in this release
`Os04g0206300`	Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027333 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000422 autophagy of mitochondrion Biological Process

GO:0000423 mitophagy Biological Process

GO:0006497 protein lipidation Biological Process

GO:0006914 autophagy Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009749 response to glucose Biological Process

GO:0009791 post-embryonic development Biological Process

KEGG gene cross-reference

ath:AT5G45900

gga:415961

hsa:10533

mmu:74244

rno:312647

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.652

Rank 1 · TkA07G050720 · TK1151

Extracellular0.221

Rank 2 · TkA07G050720 · TK1151

Cytoplasm0.185

Rank 3 · TkA07G050720 · TK1151

Cell membrane0.115

Rank 4 · TkA07G050720 · TK1151

Endoplasmic reticulum0.108

Rank 5 · TkA07G050720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08246Inhibitor_I2942-99 aa

PF08243SPT242-105 aa

PF00112Peptidase_C172-72 aa

PF00112Peptidase_C1127-344 aa

PF03051Peptidase_C1_2140-160 aa

PF16060DUF4802180-205 aa

PF03051Peptidase_C1_2285-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G050720	`PF08246`	Inhibitor_I29	42	99	5.2e-22	78.6
TkA07G050720	`PF08243`	SPT2	42	105	0.17	13.1
TkA07G050720	`PF00112`	Peptidase_C1	72	72	2e-80	270.7
TkA07G050720	`PF00112`	Peptidase_C1	127	344	2e-80	270.7
TkA07G050720	`PF03051`	Peptidase_C1_2	140	160	3.7e-05	23.5
TkA07G050720	`PF16060`	DUF4802	180	205	0.077	13.9
TkA07G050720	`PF03051`	Peptidase_C1_2	285	324	3.7e-05	23.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJ47`	Arabidopsis thaliana	sp\|Q9FJ47\|SAG12_ARATH Senescence-specific cysteine protease SAG12	57.400%	Swiss-Prot	High
`A2XQE8`	Oryza sativa subsp. indica	sp\|A2XQE8\|SAG39_ORYSI Senescence-specific cysteine protease SAG39	58.500%	Swiss-Prot	High
`Q7XWK5`	Oryza sativa subsp. japonica	sp\|Q7XWK5\|SAG39_ORYSJ Senescence-specific cysteine protease SAG39	58.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card