TkA07G029520 | RubberDandelionOmics

Gene overview

TkA07G029520

Reference: TK1151 Chr: Chr07 Coordinates: 7892794-7893243 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

450 bp · TkA07G029520|TK1151|cDNA

GAATTGTCTGCCGATGAGGAAAGAGAATTATTAGTTGAACTGAAAGTACCATCGTCGTCGTTGAGGTCCCACCAGATACTATCAGTGCGATGCTGTTACAAAGAATCAACAACTCAGGAGATCATCTACGGTAAACAACAGGCCTTGCTCGTACCTCGGCCGAACACCGTCCGATCATCTTCCCCGGCCATCCAACGGTTACGAAATCTCTTCATCACAACTCGAGCCTTAGCCGAATCAAAACGGCTAAGCGATCGAAA...

CDS

Download CDS FASTA

450 bp · TkA07G029520|TK1151|CDS

GAATTGTCTGCCGATGAGGAAAGAGAATTATTAGTTGAACTGAAAGTACCATCGTCGTCGTTGAGGTCCCACCAGATACTATCAGTGCGATGCTGTTACAAAGAATCAACAACTCAGGAGATCATCTACGGTAAACAACAGGCCTTGCTCGTACCTCGGCCGAACACCGTCCGATCATCTTCCCCGGCCATCCAACGGTTACGAAATCTCTTCATCACAACTCGAGCCTTAGCCGAATCAAAACGGCTAAGCGATCGAAA...

Protein

Download Protein FASTA

149 aa · TkA07G029520|TK1151|PROTEIN

ELSADEERELLVELKVPSSSLRSHQILSVRCCYKESTTQEIIYGKQQALLVPRPNTVRSSSPAIQRLRNLFITTRALAESKRLSDRNDLTGAYHMLLSARALLHQSNSAANEFMVGLEAEISDLQRRHKAQSPAQEAGRRGRFITTMSH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G029520`
TK1151 ID	TkA07G029520
OH-1004 ID	LXL04_024446
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.500
Protein coverage (%)	TK1151 95.302 / OH-1004 17.750 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G029520

Location Chr07:7892794-7893243 (+)

Description Similar to WAV3: E3 ubiquitin-protein ligase WAV3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49665`	E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x
`At4g37890`	Probable E3 ubiquitin-protein ligase involved in female gametophyte development.	No verified direct reference in this release
`At2g22680`	E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x
`At5g65683`	Probable E3 ubiquitin-protein ligase involved in the regulation of root growth.	The wavy growth 3 E3 ligase family controls the gravitropic response in Arabidopsis roots.2012 · DOI: 10.1111/j.1365-313x.2011.04870.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024446 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009630 gravitropism Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0010274 hydrotropism Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030212 hyaluronan metabolic process Biological Process

GO:0034097 response to cytokine Biological Process

GO:0048364 root development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0031012 extracellular matrix Cellular Component

KEGG gene cross-reference

ath:AT2G22680

ath:AT4G37890

ath:AT5G49665

ath:AT5G65683

hsa:3700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · TkA07G029520 · TK1151

Nucleus0.382

Rank 2 · TkA07G029520 · TK1151

Cell membrane0.107

Rank 3 · TkA07G029520 · TK1151

Lysosome / Vacuole0.082

Rank 4 · TkA07G029520 · TK1151

Golgi apparatus0.079

Rank 5 · TkA07G029520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25243WAV3_C61-132 aa

PF25524RSLD_CPSF668-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G029520	`PF25243`	WAV3_C	61	132	5.9e-31	106.8
TkA07G029520	`PF25524`	RSLD_CPSF6	68	123	0.051	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTA6`	Arabidopsis thaliana	sp\|Q9LTA6\|WAV3_ARATH E3 ubiquitin-protein ligase WAV3	55.900%	Swiss-Prot	High
`F4JSV3`	Arabidopsis thaliana	sp\|F4JSV3\|EDA40_ARATH Probable E3 ubiquitin-protein ligase EDA40	55.900%	Swiss-Prot	High
`Q9ZQ46`	Arabidopsis thaliana	sp\|Q9ZQ46\|WAVH1_ARATH E3 ubiquitin-protein ligase WAVH1	50.000%	Swiss-Prot	High
`Q0WQX9`	Arabidopsis thaliana	sp\|Q0WQX9\|WAVH2_ARATH Probable E3 ubiquitin-protein ligase WAVH2	44.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card