TkA07G020700 | RubberDandelionOmics

Gene overview

TkA07G020700

Reference: TK1151 Chr: Chr07 Coordinates: 5589459-5591494 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1392 bp · TkA07G020700|TK1151|cDNA

ATGAATAAATCCAAGGGAGCAAGGGCATCAGAAGGAGAATACAAGGTTGATATGATCAGTAACTTGCCAGATCATATTCTTCTATTGATTCTTTCACGTATAAAAAGTACCGAAGACGTTATTCGAACCAGGATTTTATCAACACGATGGAGGTATTTATGGACTTCAGTTCCCTTTATAGACATAGACTATACCCGAGGATTATATCCCCTAAAAGAATTTGATAGTAAAGGATTCAAAGATTTTGTAAACTGGGTTTT...

CDS

Download CDS FASTA

1392 bp · TkA07G020700|TK1151|CDS

ATGAATAAATCCAAGGGAGCAAGGGCATCAGAAGGAGAATACAAGGTTGATATGATCAGTAACTTGCCAGATCATATTCTTCTATTGATTCTTTCACGTATAAAAAGTACCGAAGACGTTATTCGAACCAGGATTTTATCAACACGATGGAGGTATTTATGGACTTCAGTTCCCTTTATAGACATAGACTATACCCGAGGATTATATCCCCTAAAAGAATTTGATAGTAAAGGATTCAAAGATTTTGTAAACTGGGTTTT...

Protein

Download Protein FASTA

463 aa · TkA07G020700|TK1151|PROTEIN

MNKSKGARASEGEYKVDMISNLPDHILLLILSRIKSTEDVIRTRILSTRWRYLWTSVPFIDIDYTRGLYPLKEFDSKGFKDFVNWVLQNKPDDLNSFRIRCADYYNISTICQWIHATVIRKVKLLDLMLHRTKDSETIVLPYCLALRVLELNDVNLYHDSVQYLLENSPTLEDLSLIDCDAHELVISCPKLKYLRIDNRLEVKDVELLDDDLDVDWRYSRTLEVCCPKLEFLRLTGYVAMYFRLQNLYSLKKAVIRTKDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G020700`
TK1151 ID	TkA07G020700
OH-1004 ID	LXL04_026955
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	78.800
Protein coverage (%)	TK1151 100.000 / OH-1004 66.933 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G020700

Location Chr07:5589459-5591494 (-)

Description Similar to FBL13: F-box/LRR-repeat protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release
`At1g78760`	Putative F-box/FBD/LRR-repeat protein At1g78760.	No verified direct reference in this release
`At1g66290`	Putative F-box/FBD/LRR-repeat protein At1g66290.	No verified direct reference in this release
`At1g78750`	F-box/FBD/LRR-repeat protein At1g78750.	No verified direct reference in this release
`At1g51370`	F-box/FBD/LRR-repeat protein At1g51370.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026955 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G69630

ath:AT1G78750

ath:AT1G78760

ath:AT3G52680

ath:AT4G13985

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.786

Rank 1 · TkA07G020700 · TK1151

Cytoplasm0.265

Rank 2 · TkA07G020700 · TK1151

Cell membrane0.047

Rank 3 · TkA07G020700 · TK1151

Endoplasmic reticulum0.042

Rank 4 · TkA07G020700 · TK1151

Plastid0.020

Rank 5 · TkA07G020700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box19-59 aa

PF12937F-box-like19-53 aa

PF23622LRR_At1g61320_AtMIF194-141 aa

PF24758LRR_At5g56370116-141 aa

PF23622LRR_At1g61320_AtMIF1129-410 aa

PF24758LRR_At5g56370145-198 aa

PF08387FBD161-175 aa

PF12799LRR_4185-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G020700	`PF00646`	F-box	19	59	3.4e-07	30.6
TkA07G020700	`PF12937`	F-box-like	19	53	0.00018	21.9
TkA07G020700	`PF23622`	LRR_At1g61320_AtMIF1	94	141	3.8e-05	24.0
TkA07G020700	`PF24758`	LRR_At5g56370	116	141	1.2e-05	25.8
TkA07G020700	`PF23622`	LRR_At1g61320_AtMIF1	129	410	3.8e-05	24.0
TkA07G020700	`PF24758`	LRR_At5g56370	145	198	1.2e-05	25.8
TkA07G020700	`PF08387`	FBD	161	175	4e-06	27.3
TkA07G020700	`PF12799`	LRR_4	185	200	0.43	11.6
TkA07G020700	`PF24758`	LRR_At5g56370	225	269	1.2e-05	25.8
TkA07G020700	`PF12799`	LRR_4	225	236	0.43	11.6
TkA07G020700	`PF24758`	LRR_At5g56370	291	338	1.2e-05	25.8
TkA07G020700	`PF12799`	LRR_4	300	313	0.43	11.6
TkA07G020700	`PF12799`	LRR_4	326	338	0.43	11.6
TkA07G020700	`PF08387`	FBD	366	403	4e-06	27.3
TkA07G020700	`PF12799`	LRR_4	369	379	0.43	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FWZ1`	Arabidopsis thaliana	sp\|Q9FWZ1\|FBL13_ARATH F-box/LRR-repeat protein 13	33.300%	Swiss-Prot	Low
`Q9ZV94`	Arabidopsis thaliana	sp\|Q9ZV94\|FDL11_ARATH Putative F-box/FBD/LRR-repeat protein At1g78760	31.900%	Swiss-Prot	Low
`Q9C8Y8`	Arabidopsis thaliana	sp\|Q9C8Y8\|FDL7_ARATH Putative F-box/FBD/LRR-repeat protein At1g66290	33.300%	Swiss-Prot	Low
`Q9ZV93`	Arabidopsis thaliana	sp\|Q9ZV93\|FDL10_ARATH F-box/FBD/LRR-repeat protein At1g78750	32.100%	Swiss-Prot	Low
`Q6DBN6`	Arabidopsis thaliana	sp\|Q6DBN6\|FDL6_ARATH F-box/FBD/LRR-repeat protein At1g51370	26.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card