TkA07G009880 | RubberDandelionOmics

Gene overview

TkA07G009880

Reference: TK1151 Chr: Chr07 Coordinates: 2705406-2708540 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1611 bp · TkA07G009880|TK1151|cDNA

CTTTTTCCTTCAATCTCAACAAAATAAAGTCCTTGTTTTTCGCTCCTCCCTCTCCCCTCTCTCTCATCACCATGGATTCAACACTTCTTCCCTAAAATTCATAAACCCTGAGAAGAGGATAACACCCACGTCACAAGATTCACCAACAATCAAAACCCAAAGACAAATTTCAAGAGAGTTATCAAAACCTTTTTGGGGGTTTGATTCGTTCCTTATAGCTTTCTTGAAAAAATTTCTCTATCTTTTCACCGATTCATTCG...

CDS

Download CDS FASTA

927 bp · TkA07G009880|TK1151|CDS

ATGTATAGATCTGGAGCTGTGATGGCTTGGAATGTGTTCAAATTCTGTACGGCCCTTAGAGGGTTAGGCTCGATCATGATCTTATTGGTTCTTGGTGTTGTTGGTGTCACCTATTACGCCGTCGTCTTATGCAATTACGGACCTGCTTTGGCCGCCGGTGGCCTTGATTCGCTCATCGCACTTCTTATCCTAATCGTATTTCATACCCTGTTGGTGATGCTACTATGGAGTTATTTTTCTGTGGTGTTCACGGACCCTGG...

Protein

Download Protein FASTA

308 aa · TkA07G009880|TK1151|PROTEIN

MYRSGAVMAWNVFKFCTALRGLGSIMILLVLGVVGVTYYAVVLCNYGPALAAGGLDSLIALLILIVFHTLLVMLLWSYFSVVFTDPGGVPPNYRPLVDQERGDIDPLEASEFGPLNSPDPTNTRIRYCRKCNQLKPPRCHHCSVCGRCVLKMDHHCVWVVNCVGALNYKYFLLFLFYTFLETTVVTLALLPHFIAFFSDGEIPGSPSTLATTFLAFVLNLAFALSVLGFLIMHISLVSANTTTIEAYEKKTTPKWRYDLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G009880`
TK1151 ID	TkA07G009880
OH-1004 ID	LXL04_026828
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G009880

Location Chr07:2705406-2708540 (+)

Description Similar to PAT14: Probable protein S-acyltransferase 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60800`	Palmitoyl acyltransferase.	No verified direct reference in this release
`At4g22750`	Palmitoyl acyltransferase.	No verified direct reference in this release
`At4g00840`	Palmitoyl acyltransferase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026828 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0010150 leaf senescence Biological Process

GO:0016188 synaptic vesicle maturation Biological Process

GO:0018345 protein palmitoylation Biological Process

GO:1900055 regulation of leaf senescence Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT3G60800

ath:AT4G00840

ath:AT4G22750

dre:561776

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.477

Rank 1 · TkA07G009880 · TK1151

Endoplasmic reticulum0.268

Rank 2 · TkA07G009880 · TK1151

Cytoplasm0.253

Rank 3 · TkA07G009880 · TK1151

Cell membrane0.169

Rank 4 · TkA07G009880 · TK1151

Lysosome / Vacuole0.098

Rank 5 · TkA07G009880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01529DHHC25-77 aa

PF01529DHHC123-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G009880	`PF01529`	DHHC	25	77	1.6e-39	135.8
TkA07G009880	`PF01529`	DHHC	123	249	1.6e-39	135.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYP5`	Arabidopsis thaliana	sp\|Q8VYP5\|ZDH14_ARATH Probable protein S-acyltransferase 14	79.800%	Swiss-Prot	High
`Q94C49`	Arabidopsis thaliana	sp\|Q94C49\|ZDH18_ARATH Probable protein S-acyltransferase 13	63.100%	Swiss-Prot	High
`Q5M757`	Arabidopsis thaliana	sp\|Q5M757\|ZDH15_ARATH Probable protein S-acyltransferase 12	53.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card