TkA06G306120 | RubberDandelionOmics

Gene overview

TkA06G306120

Reference: TK1151 Chr: Chr06 Coordinates: 76881309-76887364 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2909 bp · TkA06G306120|TK1151|cDNA

TAAGTATCGTAAACATAAAACATGGGTTTTTGTACGCGATTCATCCGAGGGATGGAATCGTTAACAAATTTTTTGTTTAGGGATTTACAATCCAAAGTTACAAGTCAAGGGAGTCCAGTGATTTGGTTCTAAAACCCCAAATTTCTTAAATTTCATCCGATTTCTATGTCCTTCCGCCTCAAAATATTCATCAAGTAGTTCGAACTTCCGACAATTCCTGCTTCAAATCATCCATCTACACCCTTCACTTCTAGGATCTA...

CDS

Download CDS FASTA

2028 bp · TkA06G306120|TK1151|CDS

ATGGAAAATGGTGTTGGGTTTGATGGAGGAGGCAATTTGACACAAGAGTTGTCTGCCTTGACTATTGGCTCTAGTGTTAATGGCTATAGCAACAGTAATGGCATGAACAAGAGCGATGGATTGTTTCAGGTTATGAAAGCCGTTGAAGCTGCTGAAGCCACAATCAAACAACAGGTGGAAGAGAATCATAGATTGAGGTCTGAGCTTCAAAAGAAGATTCAGGAACTTGAAAACTATAAATCGAGTGATAGTAAGGCTGA...

Protein

Download Protein FASTA

675 aa · TkA06G306120|TK1151|PROTEIN

MENGVGFDGGGNLTQELSALTIGSSVNGYSNSNGMNKSDGLFQVMKAVEAAEATIKQQVEENHRLRSELQKKIQELENYKSSDSKAERCGPTSYVPETKSGGLSPKATDGQVSRETPNINGFSPLRYQMEGEFDVSGLVPISEVNNAASHLNQVVIDSRDQEQEILLLRKHLVDYSIKEAQIHNEKFALEKRIAYMRLAFDQQQQDLVDAASKALSYRQDIIEENIRLTYALQDAQEERTTFVSSLMPLLAEYSLQPPVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G306120`
TK1151 ID	TkA06G306120
OH-1004 ID	LXL04_023490
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G306120`
Location	Chr06:76881309-76887364 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023490` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.470

Rank 1 · TkA06G306120 · TK1151

Cell membrane0.283

Rank 2 · TkA06G306120 · TK1151

Nucleus0.252

Rank 3 · TkA06G306120 · TK1151

Golgi apparatus0.132

Rank 4 · TkA06G306120 · TK1151

Lysosome / Vacuole0.080

Rank 5 · TkA06G306120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20892SidC_lipid-bd20-77 aa

PF04906Tweety29-81 aa

PF23742VBS_C3G930-81 aa

PF16515HIP1_clath_bdg42-87 aa

PF06156YabA42-85 aa

PF06428Sec2p43-78 aa

PF30842LEKR145-84 aa

PF07989Cnn_1N50-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G306120	`PF20892`	SidC_lipid-bd	20	77	0.0066	17.2
TkA06G306120	`PF04906`	Tweety	29	81	0.53	9.6
TkA06G306120	`PF23742`	VBS_C3G9	30	81	0.0062	17.3
TkA06G306120	`PF16515`	HIP1_clath_bdg	42	87	0.049	14.7
TkA06G306120	`PF06156`	YabA	42	85	9.0	7.7
TkA06G306120	`PF06428`	Sec2p	43	78	8.7	7.2
TkA06G306120	`PF30842`	LEKR1	45	84	1.4	9.9
TkA06G306120	`PF07989`	Cnn_1N	50	87	0.72	10.8
TkA06G306120	`PF15898`	PRKG1_interact	57	87	0.67	11.3
TkA06G306120	`PF17098`	Wtap	57	78	0.79	10.4
TkA06G306120	`PF12179`	IKKbetaNEMObind	58	75	1.0	10.0
TkA06G306120	`PF26581`	WIT1_2_N	59	79	0.54	10.7
TkA06G306120	`PF23742`	VBS_C3G9	136	157	0.0062	17.3
TkA06G306120	`PF06156`	YabA	151	202	9.0	7.7
TkA06G306120	`PF06428`	Sec2p	153	192	8.7	7.2
TkA06G306120	`PF30842`	LEKR1	158	251	1.4	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card