TkA06G152050 | RubberDandelionOmics

Gene overview

TkA06G152050

Reference: TK1151 Chr: Chr06 Coordinates: 39803367-39811976 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1722 bp · TkA06G152050|TK1151|cDNA

AAAATTACCCCCTTTTTGAATCTCTTAAAACCTCAACAAAATCCCGCTTCCTTCTCATCATTTTAAAGTGACAACACTCCGTTTTTTTTTCTCAATCGGAGCGTTGATAGTTGATACACCAGTTCCTTTCACTTTCTCTCTAAAAAGTTCAGATCAGTAATGGCAACAAACATCGGAATGATGGACGCTGCTTATTTTGTTGGCCGATCAGAGATTCTAGCGTGGATCAATAGCACTCTCCGACTCAATCTCTCCAAGGT...

CDS

Download CDS FASTA

1059 bp · TkA06G152050|TK1151|CDS

ATGGCAACAAACATCGGAATGATGGACGCTGCTTATTTTGTTGGCCGATCAGAGATTCTAGCGTGGATCAATAGCACTCTCCGACTCAATCTCTCCAAGGTCGAGGAGGCATGTTCCGGTGCGGTTCACTGTCAGCTAATGGATGTCGCACATCCTGGTGCCGTGCCGATGCACAAAGTCAATTTTGATGCCAAAACTGAATACGATATGATTCAGAATTACAAGGTTCTGCAAGATGTTTTCAACAAACTCAAGATCAC...

Protein

Download Protein FASTA

352 aa · TkA06G152050|TK1151|PROTEIN

MATNIGMMDAAYFVGRSEILAWINSTLRLNLSKVEEACSGAVHCQLMDVAHPGAVPMHKVNFDAKTEYDMIQNYKVLQDVFNKLKITKHIEVSKLVKGRPLDNLEFMQWMKRYCDSVSGGANPNYNPEGRREACKGGKDMSRKPIRSSSAVPPKSHNSRRVDTPTPNPTAPLPVKNTTVVDTSAYEQQITELKLTMDSLEKERDFYFGKLRDIEILCRLSTMSNVPGIEAIKRILYATEDDATTIEEAQAMLLNNEMNKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G152050`
TK1151 ID	TkA06G152050
OH-1004 ID	LXL04_024367
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.300
Protein coverage (%)	TK1151 94.034 / OH-1004 68.199 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G152050

Location Chr06:39803367-39811976 (+)

Description Similar to EB1C: Microtubule-associated protein RP/EB family member 1C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67270`	Plant-specific EB1 subtype that functions preferentially at early stages of plant mitosis by regulating spindle positioning and chromosome segregation.	Nuclear-localized subtype of end-binding 1 protein regulates spindle organization in Arabidopsis.2010 · DOI: 10.1242/jcs.062703
`At2g47170`	GTP-binding protein involved in protein trafficking.	BEX1/ARF1A1C is required for BFA-sensitive recycling of PIN auxin transporters and auxin-mediated development in Arabidopsis.2014 · DOI: 10.1093/pcp/pct196
`At1g23490`	GTP-binding protein involved in protein trafficking; may modulate vesicle budding and uncoating within the Golgi apparatus.	No verified direct reference in this release
`At1g70490`	GTP-binding protein involved in protein trafficking; may modulate vesicle budding and uncoating within the Golgi apparatus.	No verified direct reference in this release
`At3g47690`	Binds to the plus end of microtubules and regulates the dynamics of the microtubule cytoskeleton.	EB1 reveals mobile microtubule nucleation sites in Arabidopsis.2003 · DOI: 10.1038/ncb1057 Nuclear-localized subtype of end-binding 1 protein regulates spindle organization in Arabidopsis.2010 · DOI: 10.1242/jcs.062703

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024367 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0009652 thigmotropism Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030865 cortical cytoskeleton organization Biological Process

GO:0031001 response to brefeldin A Biological Process

GO:0031110 regulation of microtubule polymerization or depolymerization Biological Process

GO:0035372 protein localization to microtubule Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051301 cell division Biological Process

GO:0090354 regulation of auxin metabolic process Biological Process

KEGG gene cross-reference

ath:AT1G23490

ath:AT1G70490

ath:AT2G47170

ath:AT5G67270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.690

Rank 1 · TkA06G152050 · TK1151

Nucleus0.207

Rank 2 · TkA06G152050 · TK1151

Cell membrane0.158

Rank 3 · TkA06G152050 · TK1151

Golgi apparatus0.122

Rank 4 · TkA06G152050 · TK1151

Lysosome / Vacuole0.067

Rank 5 · TkA06G152050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00307CH16-107 aa

PF06294CH_220-88 aa

PF11971CAMSAP_CH35-83 aa

PF05644Miff148-202 aa

PF03271EB1199-237 aa

PF00307CH209-222 aa

PF05644Miff239-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G152050	`PF00307`	CH	16	107	3.6e-10	40.7
TkA06G152050	`PF06294`	CH_2	20	88	0.00018	22.2
TkA06G152050	`PF11971`	CAMSAP_CH	35	83	0.046	14.3
TkA06G152050	`PF05644`	Miff	148	202	0.067	13.6
TkA06G152050	`PF03271`	EB1	199	237	3.6e-16	59.9
TkA06G152050	`PF00307`	CH	209	222	3.6e-10	40.7
TkA06G152050	`PF05644`	Miff	239	285	0.067	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGQ6`	Arabidopsis thaliana	sp\|Q9FGQ6\|EB1C_ARATH Microtubule-associated protein RP/EB family member 1C	55.500%	Swiss-Prot	High
`P36397`	Arabidopsis thaliana	sp\|P36397\|ARF1_ARATH ADP-ribosylation factor 1	86.700%	Swiss-Prot	High
`Q9LQC8`	Arabidopsis thaliana	sp\|Q9LQC8\|ARF2A_ARATH ADP-ribosylation factor 2-A	86.700%	Swiss-Prot	High
`P0DH91`	Arabidopsis thaliana	sp\|P0DH91\|ARF2B_ARATH ADP-ribosylation factor 2-B	86.700%	Swiss-Prot	High
`Q7XJ60`	Arabidopsis thaliana	sp\|Q7XJ60\|EB1A_ARATH Microtubule-associated protein RP/EB family member 1A	56.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card