TkA06G101650 | RubberDandelionOmics

Gene overview

TkA06G101650

Reference: TK1151 Chr: Chr06 Coordinates: 27004976-27009189 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2461 bp · TkA06G101650|TK1151|cDNA

GTTGGATCTGAGGGTCGACTTTCCTTTCAAGCATCTACCATCGACTCCCTCACCAATCAACTAAAAACTGATGGAATAGAAGAGGAAGGGCTCGAAAATTTGCCAAAATCATATCCATGGCAGCCTAGGGTTTATCAATTTGTTAACCCCCACAATATCTCTCGACCTTAGCTGTGTTCTGTCATGGCCTCCGCTGTCACAGGGCTCCTGTTCTTTCTTTTATTACTCTCCAATCTTCATGTTTCTTTCTCTGCTTCTGG...

CDS

Download CDS FASTA

2034 bp · TkA06G101650|TK1151|CDS

ATGGCCTCCGCTGTCACAGGGCTCCTGTTCTTTCTTTTATTACTCTCCAATCTTCATGTTTCTTTCTCTGCTTCTGGACAGTTGGCATTCGAGTCAGTTCCCGACCTAGAGAAATCCATGTACAAGGTCATAGATGGATATCCATGTATACGATTACTCAACCTTTCAGGGGAAATCGGCTGTGCAAATCCTGGCCTTGATAAGGTTGTAGCTCGTGTTGTTAGATTCAAGAATGGTATAGAATTGGTTGAGTCCAGCTC...

Protein

Download Protein FASTA

677 aa · TkA06G101650|TK1151|PROTEIN

MASAVTGLLFFLLLLSNLHVSFSASGQLAFESVPDLEKSMYKVIDGYPCIRLLNLSGEIGCANPGLDKVVARVVRFKNGIELVESSSVLVPLSDFDNLLSRVSSDSNFARNLAGVLVESEPQNQTNLTGLSPDNKFPQAEFSPYQNNKFEWNPSGSGIMWGLYEFPVFLLSESSTQTLQEIALQNENRETHAIKVTEFDIVMQTTKAGTHDSESCLREGTCLPLGGYSVWSALPTTNISSSKSKPIVLTVASMDSASFFR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G101650`
TK1151 ID	TkA06G101650
OH-1004 ID	LXL04_029016
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	75.000
Protein coverage (%)	TK1151 5.318 / OH-1004 9.863 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G101650

Location Chr06:27004976-27009189 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8GUM5`	Probable subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral membrane proteins such as Notch.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029016 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.421

Rank 1 · TkA06G101650 · TK1151

Cell membrane0.206

Rank 2 · TkA06G101650 · TK1151

Golgi apparatus0.198

Rank 3 · TkA06G101650 · TK1151

Cytoplasm0.184

Rank 4 · TkA06G101650 · TK1151

Endoplasmic reticulum0.165

Rank 5 · TkA06G101650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18266Ncstrn_small48-204 aa

PF04389Peptidase_M28241-451 aa

PF05450Nicastrin245-454 aa

PF18266Ncstrn_small263-303 aa

PF18266Ncstrn_small407-419 aa

PF18266Ncstrn_small503-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G101650	`PF18266`	Ncstrn_small	48	204	1.2e-37	130.2
TkA06G101650	`PF04389`	Peptidase_M28	241	451	4.9e-08	33.7
TkA06G101650	`PF05450`	Nicastrin	245	454	3e-78	263.1
TkA06G101650	`PF18266`	Ncstrn_small	263	303	1.2e-37	130.2
TkA06G101650	`PF18266`	Ncstrn_small	407	419	1.2e-37	130.2
TkA06G101650	`PF18266`	Ncstrn_small	503	539	1.2e-37	130.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUM5`	Arabidopsis thaliana	sp\|Q8GUM5\|NICA_ARATH Nicastrin	59.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card