TkA06G101630 | RubberDandelionOmics

Gene overview

TkA06G101630

Reference: TK1151 Chr: Chr06 Coordinates: 26998784-27002890 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2711 bp · TkA06G101630|TK1151|cDNA

CCTAACATGAACAACGTTCAGAGGGTCTGTTCCACTGCTGGTGAATGGTGCCTACGGTGTACACACGCCCTGTCCCAATTCTCCGGCTAACCTTCTGCAAAAACTCCATTTATCTACTTTCCTTCCCCAACTTCTAGAGGGAGAAACCATAGATTTCTAGCCAGAAAGAGCGAGAATCAATGGGATTGGGTTCGCTAGCCTCCAGAGCTCTTCGATCGTCATCTTCATCTAGGGTTTTGTCAACAAATCCTAGATACAAT...

CDS

Download CDS FASTA

2232 bp · TkA06G101630|TK1151|CDS

ATGGGATTGGGTTCGCTAGCCTCCAGAGCTCTTCGATCGTCATCTTCATCTAGGGTTTTGTCAACAAATCCTAGATACAATCTTATTCGAACCATCGTCTCCACACCTGAGCTTCACAAACCTGAAGCCGCGGCCGAATCGGCATCTGAGCCCGATCTACCAAAGCGCACTCCTGTTGCCGGAGCTAGGGTTCATTTCCCCAATCCAGATGATGTTATCGAGGTCTTTGTGGATGGATATCCCGTTAAGATCCCGAAGGG...

Protein

Download Protein FASTA

743 aa · TkA06G101630|TK1151|PROTEIN

MGLGSLASRALRSSSSSRVLSTNPRYNLIRTIVSTPELHKPEAAAESASEPDLPKRTPVAGARVHFPNPDDVIEVFVDGYPVKIPKGMTVLQACSVAGVDIPRFCYHDRLSIAGNCRMCLVEVEKSPKPVASCAMPALPGMKIKTDTPIAKKAREGVMEFLLMNHPLDCPICDQGGECDLQDQSMAFGSDRGRFTETKRSVVDKNLGPLVKTVMTRCIQCTRCVRFASEIAGVQDLGMLGRGSGEEIGTYVEKLMTSELS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G101630`
TK1151 ID	TkA06G101630
OH-1004 ID	LXL04_024854
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G101630

Location Chr06:26998784-27002890 (-)

Description Similar to NADH dehydrogenase [ubiquinone] iron-sulfur protein 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g37510`	Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024854 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009853 photorespiration Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0042773 ATP synthesis coupled electron transport Biological Process

GO:0042776 proton motive force-driven mitochondrial ATP synthesis Biological Process

GO:0045333 cellular respiration Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G37510

hsa:4719

ppyg:129031966

sot:102594243

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.905

Rank 1 · TkA06G101630 · TK1151

Cytoplasm0.055

Rank 2 · TkA06G101630 · TK1151

Plastid0.049

Rank 3 · TkA06G101630 · TK1151

Nucleus0.038

Rank 4 · TkA06G101630 · TK1151

Cell membrane0.020

Rank 5 · TkA06G101630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13510Fer2_472-147 aa

PF00111Fer276-125 aa

PF10588NADH-G_4Fe-4S_3154-191 aa

PF00111Fer2157-178 aa

PF22117Fer4_Nqo3207-273 aa

PF00037Fer4214-225 aa

PF00037Fer4265-273 aa

PF22151Fer4_NDSU1286-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G101630	`PF13510`	Fer2_4	72	147	1.2e-19	70.8
TkA06G101630	`PF00111`	Fer2	76	125	2e-06	28.4
TkA06G101630	`PF10588`	NADH-G_4Fe-4S_3	154	191	7.9e-17	61.2
TkA06G101630	`PF00111`	Fer2	157	178	2e-06	28.4
TkA06G101630	`PF22117`	Fer4_Nqo3	207	273	2.2e-33	115.0
TkA06G101630	`PF00037`	Fer4	214	225	0.36	11.4
TkA06G101630	`PF00037`	Fer4	265	273	0.36	11.4
TkA06G101630	`PF22151`	Fer4_NDSU1	286	336	3.1e-30	104.1
TkA06G101630	`PF00384`	Molybdopterin	342	662	1e-104	351.1
TkA06G101630	`PF13510`	Fer2_4	437	456	1.2e-19	70.8
TkA06G101630	`PF09326`	NADH_dhqG_C	704	736	3e-13	50.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGI6`	Arabidopsis thaliana	sp\|Q9FGI6\|NDUS1_ARATH NADH dehydrogenase [ubiquinone] iron-sulfur protein 1, mitochondrial	78.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card