TkA06G097930 | RubberDandelionOmics

Gene overview

TkA06G097930

Reference: TK1151 Chr: Chr06 Coordinates: 26076759-26078983 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2022 bp · TkA06G097930|TK1151|cDNA

GAAAAGTACACAATTTATGGAATTTGTGGCAACTACTGGACTAAAGGCCAATTAACTTGACTAGTCAACTATGGTATGTAAAAGATATTATTAAACAAACAAGAACAAGCCATCCTAGTCCACCATGTCCATCTACTCTTGGCGCTGTTCGGAAACACCAAGCCACTGCCACTGCCACTGACATGAAAATATCTATATAAAAACCATGCCGTTCATTACCCCAAAATCATTCCAAAACTCATTAACTTTTCTCCATTTCC...

CDS

Download CDS FASTA

1482 bp · TkA06G097930|TK1151|CDS

ATGGAGATTTCCGTCACCGCTACCCTTGGCCTTGCCGCCATCATCTTCATCATTTTCAAGCTAGTAACACGTCCCAAATCAAAGAAAAACCTGCTTCCAGAACCATGGAGACTACCGATAATCGGACACATGCATCATCTGATAGGTACCATGCCACATCGTGGTGTGATGGATTTAGCCAGGAAGCATGGGCCACTCATGCATCTACAACTTGGAGAAGTGTCGACAATCGTGGTCTCATCCCCACGTTGGGCAAAAGA...

Protein

Download Protein FASTA

493 aa · TkA06G097930|TK1151|PROTEIN

MEISVTATLGLAAIIFIIFKLVTRPKSKKNLLPEPWRLPIIGHMHHLIGTMPHRGVMDLARKHGPLMHLQLGEVSTIVVSSPRWAKEVLTTYDITFANRPETLTGEIVAYHNTDIVLAPYGEYWRQLRKLCTLELLSNKKVKSFQSLREEECWNLVKDIRSTGQGPVNLSENIFKMIATILSRAAFGKGIKDQKKFTELVKEILRLTGGFDVADIFPSKTLLHHLSGKRAKLTNIHNKLDSLIDNIIAEHPGNRTTSSQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G097930`
TK1151 ID	TkA06G097930
OH-1004 ID	LXL04_024889
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G097930`
Location	Chr06:26076759-26078983 (+)
Description	Similar to CYP71AV8: Cytochrome P450 71AV8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024889` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016114 terpenoid biosynthetic process Biological Process GO:0051762 sesquiterpene biosynthetic process Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0004497 monooxygenase activity Molecular Function GO:0005506 iron ion binding Molecular Function GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function GO:0020037 heme binding Molecular Function GO:0106223 germacrene A hydroxylase activity Molecular Function
KEGG gene cross-reference	ag:ADF32078 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.927

Rank 1 · TkA06G097930 · TK1151

Cell membrane0.048

Rank 2 · TkA06G097930 · TK1151

Cytoplasm0.044

Rank 3 · TkA06G097930 · TK1151

Golgi apparatus0.022

Rank 4 · TkA06G097930 · TK1151

Plastid0.021

Rank 5 · TkA06G097930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45034-476 aa

PF25308Rgr-1_C227-309 aa

PF12205GIT1_C227-267 aa

PF12205GIT1_C228-251 aa

PF12205GIT1_C260-319 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G097930	`PF00067`	p450	34	476	2.3e-101	340.6
TkA06G097930	`PF25308`	Rgr-1_C	227	309	0.1	12.8
TkA06G097930	`PF12205`	GIT1_C	227	267	0.12	13.3
TkA06G097930	`PF12205`	GIT1_C	228	251	0.12	13.3
TkA06G097930	`PF12205`	GIT1_C	260	319	0.12	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card