RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G024720
Reference: TK1151 Chr: Chr06 Coordinates: 6721483-6723453 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1809 bp · TkA06G024720|TK1151|cDNA

ATGGCATCCATCTGGGCCAATCCGGCTGCTTCTCAATCTCATACCAATACGACGGCGGTACCTGTTCCTCCGGCGTCATCATCTGCTTCAACCTCCGATCCGCACAAGATAGTCAACGATTTCAATCCGGATACTTTACAGCAACGCCTCCAGGGGTTGATTGATACGGCACGGGAGTCGTGGACTTACGCTATATTCTGGCAGTCGTCTCACGTCGATTACACGGATACTCCGGTGTTAGGGTGGGGAGATGGGTATTA...

CDS

Download CDS FASTA

1809 bp · TkA06G024720|TK1151|CDS

ATGGCATCCATCTGGGCCAATCCGGCTGCTTCTCAATCTCATACCAATACGACGGCGGTACCTGTTCCTCCGGCGTCATCATCTGCTTCAACCTCCGATCCGCACAAGATAGTCAACGATTTCAATCCGGATACTTTACAGCAACGCCTCCAGGGGTTGATTGATACGGCACGGGAGTCGTGGACTTACGCTATATTCTGGCAGTCGTCTCACGTCGATTACACGGATACTCCGGTGTTAGGGTGGGGAGATGGGTATTA...

Protein

Download Protein FASTA

602 aa · TkA06G024720|TK1151|PROTEIN

MASIWANPAASQSHTNTTAVPVPPASSSASTSDPHKIVNDFNPDTLQQRLQGLIDTARESWTYAIFWQSSHVDYTDTPVLGWGDGYYKGEVNKVKTKPSATSLAEQQYRKKVLRELNSLISGSQAPESDAVDEEVTDTEWFFLISMTQSFVNGNGLPGQAAFSNQPVWVAGRERLMASHCERARQGQGFGLQTIVCIPSADGVIELGSTEINTIQPAGGDNDPSSIWLTDPVATSTTTSVIPSITSHVPNPSSSSLPENP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G024720
TK1151 IDTkA06G024720
OH-1004 IDLXL04_026146
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)91.300
Protein coverage (%)TK1151 100.000 / OH-1004 89.617
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G024720
LocationChr06:6721483-6723453 (-)
DescriptionSimilar to MYC2: Transcription factor MYC2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g32640 Transcriptional activator.
Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling.2003 · DOI: 10.1105/tpc.006130
JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis.2004 · DOI: 10.1105/tpc.022319
A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth.2005 · DOI: 10.1105/tpc.105.032060
Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408
The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788
The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis.2011 · DOI: 10.1105/tpc.111.089870
Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression.2012 · DOI: 10.1105/tpc.112.098749
Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139
Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.1997 · DOI: 10.1105/tpc.9.10.1859
At5g46760 Transcription factor involved in tryptophan, jasmonic acid (JA) and other stress-responsive gene regulation.
The bHLH transcription factor MYC3 interacts with the Jasmonate ZIM-domain proteins to mediate jasmonate response in Arabidopsis.2011 · DOI: 10.1093/mp/ssq073
Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408
The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788
Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139

Rice

Reference gene IDPossible functionPapers / DOI
Os10g0575000 Transcriptional activator involved in jasmonate (JA) signaling pathway during spikelet development.
Jasmonic acid regulates spikelet development in rice.2014 · DOI: 10.1038/ncomms4476
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026146 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006568 L-tryptophan metabolic process Biological Process
GO:0006952 defense response Biological Process
GO:0009269 response to desiccation Biological Process
GO:0009611 response to wounding Biological Process
GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0009759 indole glucosinolate biosynthetic process Biological Process
GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process
KEGG gene cross-reference
ath:AT1G32640
ath:AT4G17880
dosa:Os10g0575000
osa:4349484
sly:101261048
sly:544165
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.929
Rank 1 · TkA06G024720 · TK1151
Cytoplasm0.120
Rank 2 · TkA06G024720 · TK1151
Cell membrane0.051
Rank 3 · TkA06G024720 · TK1151
Endoplasmic reticulum0.035
Rank 4 · TkA06G024720 · TK1151
Plastid0.018
Rank 5 · TkA06G024720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215bHLH-MYC_N46-210 aa
PF00010HLH102-112 aa
PF17208RBR332-355 aa
PF17208RBR398-412 aa
PF23181bHLH_INO4419-483 aa
PF00010HLH420-466 aa
PF23177bHLH_IRO3423-489 aa
PF23173bHLH_SAC51425-473 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G024720PF14215bHLH-MYC_N462109.7e-51173.3
TkA06G024720PF00010HLH1021121.4e-1144.7
TkA06G024720PF17208RBR3323550.2312.9
TkA06G024720PF17208RBR3984120.2312.9
TkA06G024720PF23181bHLH_INO44194830.007817.0
TkA06G024720PF00010HLH4204661.4e-1144.7
TkA06G024720PF23177bHLH_IRO34234894.3e-1143.8
TkA06G024720PF23173bHLH_SAC514254730.0001522.3
TkA06G024720PF17082Spc294405440.03214.8
TkA06G024720PF18035Bap31_Bap29_C4624890.0414.7
TkA06G024720PF00831Ribosomal_L294745000.08413.6
TkA06G024720PF14215bHLH-MYC_N4755099.7e-51173.3
TkA06G024720PF00010HLH4785041.4e-1144.7
TkA06G024720PF22754bHLH-TF_ACT-like_plant5235943.8e-0627.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q39204Arabidopsis thalianasp|Q39204|MYC2_ARATH Transcription factor MYC251.400%Swiss-ProtHigh
Q9FIP9Arabidopsis thalianasp|Q9FIP9|MYC3_ARATH Transcription factor MYC345.800%Swiss-ProtMedium
Q336P5Oryza sativa subsp. japonicasp|Q336P5|MYC2_ORYSJ Transcription factor MYC245.900%Swiss-ProtMedium

JBrowse

View in Genome Browser