TkA05G464980 | RubberDandelionOmics

Gene overview

TkA05G464980

Reference: TK1151 Chr: Chr05 Coordinates: 116509857-116510297 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

411 bp · TkA05G464980|TK1151|cDNA

ATGTCAATCATCCCAAGTTTCTTCGGTGGTCGTCGAACAAACGTCTTCGATCCCTTCTCCCTGGATATCTGGGATCCTTTCGAGGGCTTCCCCTATCGCGTCGGATCGTCTGAAACAGCGTCGTTCGCAAGCGCGGACATCGACTGGAAGGAGACTGCCGATGCTTACGTGTTCAAGGCGGATGTGCCAGGGCTGAAAAAGGAGGAAGTGAAGGTTGAAGTTGAGGACGATCGGGTGCTCCAGATCAGTGGAGAGAGGAA...

CDS

Download CDS FASTA

411 bp · TkA05G464980|TK1151|CDS

ATGTCAATCATCCCAAGTTTCTTCGGTGGTCGTCGAACAAACGTCTTCGATCCCTTCTCCCTGGATATCTGGGATCCTTTCGAGGGCTTCCCCTATCGCGTCGGATCGTCTGAAACAGCGTCGTTCGCAAGCGCGGACATCGACTGGAAGGAGACTGCCGATGCTTACGTGTTCAAGGCGGATGTGCCAGGGCTGAAAAAGGAGGAAGTGAAGGTTGAAGTTGAGGACGATCGGGTGCTCCAGATCAGTGGAGAGAGGAA...

Protein

Download Protein FASTA

136 aa · TkA05G464980|TK1151|PROTEIN

MSIIPSFFGGRRTNVFDPFSLDIWDPFEGFPYRVGSSETASFASADIDWKETADAYVFKADVPGLKKEEVKVEVEDDRVLQISGERNKESEEKGDTWHRVERSSGKFMRRFKLPENAKVDQVKACYRFITQFNFVT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G464980`
TK1151 ID	TkA05G464980
OH-1004 ID	LXL04_012328
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	88.900
Protein coverage (%)	TK1151 91.176 / OH-1004 82.822 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G464980

Location Chr05:116509857-116510297 (+)

Description Similar to HSP18.5-C: 18.5 kDa class I heat shock protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46230`	17.4 kDa class I heat shock protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012328 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0009651 response to salt stress Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0051259 protein complex oligomerization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0051082 unfolded protein binding Molecular Function

KEGG gene cross-reference

gmx:100305750

gmx:100499727

gmx:100526870

gmx:100791172

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.622

Rank 1 · TkA05G464980 · TK1151

Nucleus0.375

Rank 2 · TkA05G464980 · TK1151

Mitochondrion0.099

Rank 3 · TkA05G464980 · TK1151

Endoplasmic reticulum0.089

Rank 4 · TkA05G464980 · TK1151

Cell membrane0.076

Rank 5 · TkA05G464980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14706Tnp_DNA_bind35-58 aa

PF31004IDM_C47-127 aa

PF00011HSP2048-125 aa

PF17886ArsA_HSP2054-83 aa

PF27746Small_heat_shock_put56-86 aa

PF14706Tnp_DNA_bind120-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G464980	`PF14706`	Tnp_DNA_bind	35	58	0.11	12.8
TkA05G464980	`PF31004`	IDM_C	47	127	4.2e-05	23.9
TkA05G464980	`PF00011`	HSP20	48	125	5.4e-23	81.7
TkA05G464980	`PF17886`	ArsA_HSP20	54	83	0.2	12.0
TkA05G464980	`PF27746`	Small_heat_shock_put	56	86	0.091	12.7
TkA05G464980	`PF14706`	Tnp_DNA_bind	120	130	0.11	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P19036`	Arabidopsis thaliana	sp\|P19036\|HSP17_ARATH 17.4 kDa class I heat shock protein	72.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card