TkA05G450410 | RubberDandelionOmics

Gene overview

TkA05G450410

Reference: TK1151 Chr: Chr05 Coordinates: 112626214-112628910 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2242 bp · TkA05G450410|TK1151|cDNA

CTGCTTTTGAGGCCAAATAAAACCAAAGCCTGTTATCATCTTTCCCTTTCTCTTTCTCTTTCTCTCTCAAAGGAAAGCATAAAGGAAAAAGATCACAGCAATAGCAATGGCATCCTTACTTTTCGTCCTTTGATCAATCCCCATTTTACTACTCCATTGATCCATCCTTCCTTTTTTCTCAAAACCCTAGGTAAGGTGTAGGTCATTGGGTCCCCAAAAGTTCAAAAAAAGCAGCTCCTCTCCTCTCCTCTCTTCTTTGA...

CDS

Download CDS FASTA

1236 bp · TkA05G450410|TK1151|CDS

ATGGCGTCAGAGCAGATCAGATTTCTGCAGCAGCAACATCAACCTGCGTCTTCCCGGCGAAAGAGATGGGGAGGATGTATAACCGGTTTATCTTGTTTCGGCTTGCAAAAAGGCGGAAAGCGTGTTGTACCTGCATCTCGTATGCCGGAAACCCATCCAACAGCAAACCAGCAAAACGGACCTCAAGCCGTCGGACTAACCAACCAAAACAACTCGGTACACCCATCTCTCTTAGCTCCACCTTCTTCTCCGGCCTCCTT...

Protein

Download Protein FASTA

411 aa · TkA05G450410|TK1151|PROTEIN

MASEQIRFLQQQHQPASSRRKRWGGCITGLSCFGLQKGGKRVVPASRMPETHPTANQQNGPQAVGLTNQNNSVHPSLLAPPSSPASFSNSALQSTVQSPNCFLSANSPGGPSSTMFATGPYAHETQLVSPPVFSTFTTEPSTAPLTPPPELAHLTTPSSPDVPYAQFLSSSLNLKRGDKTNYMTANDLQATYSLYPGSPASTLRSPISRSPISRTSGEGLSSSFPERDFSPQWTPSTPSQNNKPQDANFFCPETFAQFYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G450410`
TK1151 ID	TkA05G450410
OH-1004 ID	LXL04_022204
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G450410

Location Chr05:112626214-112628910 (+)

Description Similar to At1g76660: Uncharacterized protein At1g76660

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76660`	Uncharacterized protein At1g76660.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022204 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G76660

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.509

Rank 1 · TkA05G450410 · TK1151

Nucleus0.282

Rank 2 · TkA05G450410 · TK1151

Cell membrane0.245

Rank 3 · TkA05G450410 · TK1151

Golgi apparatus0.057

Rank 4 · TkA05G450410 · TK1151

Mitochondrion0.057

Rank 5 · TkA05G450410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30477At1g766604-345 aa

PF30477At1g76660364-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G450410	`PF30477`	At1g76660	4	345	1.8e-156	522.6
TkA05G450410	`PF30477`	At1g76660	364	411	1.8e-156	522.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRE5`	Arabidopsis thaliana	sp\|Q9SRE5\|Y1666_ARATH Uncharacterized protein At1g76660	57.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card